Thursday, May 19, 2022

It's In The GenBank - 6

Fig. 1 Transcription: DNA~>mRNA

I. Introduction

Making a sequence of a virus genome is not as scientifically well-developed as one would think:

"Obtaining virus genome sequence directly from clinical samples is still a challenging task due to the low load of virus genetic material compared to the host DNA, and to the difficulty to get an accurate genome assembly."

(A complete protocol for whole-genome sequencing). The quote from that article indicates that the reasons for the difficulty are: 1) "due to the low load of virus genetic material compared to the host DNA", and 2) "the difficulty to get an accurate genome assembly" (ibid).

The article goes on to list how defects, which can appear to be 'mutations' or 'variants', happen all too often.

In a previous post in this series the Wuhan SARS-CoV-2 comparison to the Omicron 'variant' was questioned (It's In The GenBank - 4).

II. Big Pharma Virus Propaganda

Even the very nature of the virus realm is still foggy:

"Viruses have generally been characterized by their detrimental effects, particularly their pathogenic ones. Examples abound of human, animal, and plant viruses that reduce host fitness, and Section 2 below recalls that, given the number of past and present human deaths due to viruses, it is by no means surprising that viruses are generally perceived as harmful.

In that context, the recent claim that many viruses can in fact be mutualistic, i.e., have beneficial effects on host fitness, was a bombshell to many."

 (Mutualistic viruses and the heteronomy of life). Within the realm where virus genomes are "defined" (using the money of Big Pharma; cf. Who Picks Up the Tab for Science?), some scientific definitions are changing:

"Viruses are being redefined as more than just pathogens. They are also critical symbiotic partners in the health of their hosts. In some cases, viruses have fused with their hosts in symbiogenetic relationships. Mutualistic interactions are found in plant, insect, and mammalian viruses, as well as with eukaryotic and prokaryotic microbes, and some interactions involve multiple players of the holobiont. With increased virus discovery, more mutualistic interactions are being described and more will undoubtedly be discovered."

(Viruses make their mark as mutualistic microbial symbionts). It is not a surprise that funding by "the powers that be" flows in directions that benefit the one funding the money ("I suspect the existence of what I call the `John Mercer effect' ... the scientists preaching caution and downplaying the dangers ... fared better in receipt of research funding." - Dr. James Hansen, link).

III. But I Digress

"All of the RNA in a cell is made by DNA transcription" (From DNA to RNA, emphasis added). So, the Wuhan SARS-CoV-2 RNA virus as well as the Omicron 'variant' RNA virus are made by a cell's DNA transcription machinery inside the cell nucleus as was pointed out in  (On The Origin Of The Home Of COVID-19 - 29).

Getting back to the nucleotide sequences of viruses within their host microbe, let us revisit the comparison of the Wuhan SARS-CoV-2 virus nucleotide sequence with the Omicron 'variant' nucleotide sequence (ibid).

IV. What's Up With The
Wuhan/Omicron
GenBank Sequences?

The (Wuhan, Omicron) sequences in GenBank do not utilize the proper nucleotide nomenclature for RNA:

"DEFINITION  Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome.

...

FEATURES   Location/Qualifiers
     source      1..29903
                     /organism="Severe acute respiratory syndrome coronavirus 2"
                     /mol_type="genomic RNA

...

[FASTA version ]

ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTC ..."

(Wuhan, emphasis added). The video below, and every other savvy source informs us that there are no "T" bases in RNA, those bases are only in "DNA".

Which means that the Wuhan and Omicron nucleotide sequences feature the DNA of the host that the SARS-CoV-2 RNA is in.

Which means that the mRNA transcription in the appendices of the aforesaid Dredd Blog post (Wuhan, "Mutants-Wuhan", Omicron, "Mutants-Omicron") feature the SARS-CoV-2 RNA!

It would be nice if the GenBank folks would clearly point that out in their .gbff and .fna files, rather than erroneously indicating that the "RNA genomes ... /mol_type=genomic RNA" are of a SARS-CoV-2 virus.

Perhaps they do not do so because the host, in cases where the virus is detected in microbes, is not known.

V. Closing Comments

Evidently these problems are going to be with us for a long time:

"A virus [SARS-CoV-2] that shows no signs of disappearing, variants that are adept at dodging the body’s defenses and waves of infections two, maybe three times a year — this may be the future of COVID-19, some scientists now fear."

(How Often Can You Be Infected With the Coronavirus?). As long as it takes?

The previous post in this series is here.





Tuesday, May 17, 2022

On The Origin Of The Home Of COVID-19 - 29

Mother Jones on Eating Habits

I. Background

Regular readers of this extensive Dredd Blog series know that it is about "the mass-production-of-animals-for-food industry".

But it is also about the SARS-CoV-2 virus and the COVID-19 disease it is said to cause.

I have furnished copious appendices in this series detailing various aspects of the GenBank nucleotide data available there at only the cost of the value of the time it takes to look up the vast array stored there.

II. A 'Radical' Discovery

The relevant fad lately in this narrative is the Omicron variant group, which is said to be a cause for concern because it is not a substantial likeness to the "original" located at or around Wuhan China a million American deaths ago.

Regular readers also know that Dredd Blog has produced an excruciating amount of DNA/RNA appendices to posts in this series relating to Coronaviruses.

Today I am only using four appendices to support the assertions in today's post (Wuhan, "Mutants"-Wuhan, Omicron, "Mutants"-Omicron).

[In this transcription and translation "mutant" means it was not found between a start codon and a stop codon, but was in the base pairs. (c.f. What is a mutation? here, here, and here)]

The HTML tables in the four appendices show that "The Mother of All SARS-CoV-2 viruses" (the original from Wuhan in December of 2019) is not substantially different from the Omicron Variant of 2022.

That is based on an analysis of two nucleotide records (Wuhan, Omicron).

III. The Sameness

So, how do I mean "substantially the same?" you may be wondering.

Ok.

Consider a recent post featuring a video in classroom format, by MIT a.k.a Massachusetts Institute of Technology (see video below).

That video illustrates the science of how mRNA (messenger RNA) is constructed from DNA inside eukaryotic cells of humans or microbes.

Compare the four appendices of today's post and you will see that the standard codons (those in the primary genetic code) as well as the "mutant" codons are exactly the same (down to the atom counts) in the Wuhan and Omicron SARS-CoV-2 Nucleotide data used to decipher the mRNA. [In this transcription and translation "mutant" means it was not found between a start codon and a stop codon, but was elsewhere in the base pairs.]

In other words no difference between normal and "mutant" codons in the nucleotides of Wuhan vs Omicron sequences were found when I translated and transcribed them (see video below). 

IV. mRNA

The mRNA is constructed within the nucleus then sent to ribosomes located outside of the cell nucleus in the cytoplasm (of the cell).

For the original Wuhan to be the same as the recent BA.2 Omicron raises the question "what Omicron variants?".

V. Closing Comments

This Dredd Blog series has hypothesized that the mass-production-of-animals-for-food industry's chemical practices (overuse of antibiotics etc.) is the cause of many problems, including the advent of SARS-CoV-2 and the COVID-19 disease that virus causes (On The Origin Of The Home Of COVID-19, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28).

In cultures where religion (The Machine Religion, 2, 3, 4) shapes and forges economies we find institutions which are "too big to fail".

The mass-production-of-animals-for-food industry seems to be one of them.

The next post in this series is here, previous post in this series is here.


From MIT:


Appendix Mutant Omicron

 This is an appendix to: On The Origin Of The Home Of COVID-19 - 29


Codons, Amino Acids and Chemical Formulas
Arranged By Order-of-appearance
In The Nucleotides of
VERSION: OM617939.1

Codon_MUT Amino Acid
('AA')
AA
Abbr.
AA
Ltr
Codon[1]
(formula)
Codon[2]
(formula)
Codon[3]
(formula)
Total Atoms
In Codon
CAG Glutamine GLN Q C4H5N3O1 C5H5N5 C5H5N5O1 C14H15N13O2
GUG Valine VAL V C5H5N5O1 C4H4N2O2 C5H5N5O1 C14H14N12O4
GAU Aspartic acid ASP D C5H5N5O1 C5H5N5 C4H4N2O2 C14H14N12O3
CAA Glutamine GLN Q C4H5N3O1 C5H5N5 C5H5N5 C14H15N13O1
UUU Phenylalanine PHE F C4H4N2O2 C4H4N2O2 C4H4N2O2 C12H12N6O6
CCC Proline PRO P C4H5N3O1 C4H5N3O1 C4H5N3O1 C12H15N9O3
GCA Alanine ALA A C5H5N5O1 C4H5N3O1 C5H5N5 C14H15N13O2
AAA Lysine LYS K C5H5N5 C5H5N5 C5H5N5 C15H15N15O0
AAA Lysine LYS K C5H5N5 C5H5N5 C5H5N5 C15H15N15O0
AUU Isoleucine ILE I C5H5N5 C4H4N2O2 C4H4N2O2 C13H13N9O4
UGC Cysteine CYS C C4H4N2O2 C5H5N5O1 C4H5N3O1 C13H14N10O4
GUG Valine VAL V C5H5N5O1 C4H4N2O2 C5H5N5O1 C14H14N12O4
UUU Phenylalanine PHE F C4H4N2O2 C4H4N2O2 C4H4N2O2 C12H12N6O6
CCG Proline PRO P C4H5N3O1 C4H5N3O1 C5H5N5O1 C13H15N11O3
GUG Valine VAL V C5H5N5O1 C4H4N2O2 C5H5N5O1 C14H14N12O4
AAG Lysine LYS K C5H5N5 C5H5N5 C5H5N5O1 C15H15N15O1
CCU Proline PRO P C4H5N3O1 C4H5N3O1 C4H4N2O2 C12H14N8O4
ACA Threonine THR T C5H5N5 C4H5N3O1 C5H5N5 C14H15N13O1
AUC Isoleucine ILE I C5H5N5 C4H4N2O2 C4H5N3O1 C13H14N10O3
U






U






CCU Proline PRO P C4H5N3O1 C4H5N3O1 C4H4N2O2 C12H14N8O4
AUA Isoleucine ILE I C5H5N5 C4H4N2O2 C5H5N5 C14H14N12O2
UUU Phenylalanine PHE F C4H4N2O2 C4H4N2O2 C4H4N2O2 C12H12N6O6
GAG Glutamic acid GLU E C5H5N5O1 C5H5N5 C5H5N5O1 C15H15N15O2
AUU Isoleucine ILE I C5H5N5 C4H4N2O2 C4H4N2O2 C13H13N9O4
GUC Valine VAL V C5H5N5O1 C4H4N2O2 C4H5N3O1 C13H14N10O4
AUA Isoleucine ILE I C5H5N5 C4H4N2O2 C5H5N5 C14H14N12O2
GUC Valine VAL V C5H5N5O1 C4H4N2O2 C4H5N3O1 C13H14N10O4
GUG Valine VAL V C5H5N5O1 C4H4N2O2 C5H5N5O1 C14H14N12O4
GUU Valine VAL V C5H5N5O1 C4H4N2O2 C4H4N2O2 C13H13N9O5
AUC Isoleucine ILE I C5H5N5 C4H4N2O2 C4H5N3O1 C13H14N10O3
GAC Aspartic acid ASP D C5H5N5O1 C5H5N5 C4H5N3O1 C14H15N13O2
C






Appendix Mutant Wuhan

This is an appendix to: On The Origin Of The Home Of COVID-19 - 29


Codons, Amino Acids and Chemical Formulas
Arranged By Order-of-appearance
In The Nucleotides of
VERSION: NC_045512.2

Codon_MUT Amino Acid
('AA')
AA
Abbr.
AA
Ltr
Codon[1]
(formula)
Codon[2]
(formula)
Codon[3]
(formula)
Total Atoms
In Codon
CAG Glutamine GLN Q C4H5N3O1 C5H5N5 C5H5N5O1 C14H15N13O2
GUG Valine VAL V C5H5N5O1 C4H4N2O2 C5H5N5O1 C14H14N12O4
GAU Aspartic acid ASP D C5H5N5O1 C5H5N5 C4H4N2O2 C14H14N12O3
CAA Glutamine GLN Q C4H5N3O1 C5H5N5 C5H5N5 C14H15N13O1
UUU Phenylalanine PHE F C4H4N2O2 C4H4N2O2 C4H4N2O2 C12H12N6O6
CCC Proline PRO P C4H5N3O1 C4H5N3O1 C4H5N3O1 C12H15N9O3
GCA Alanine ALA A C5H5N5O1 C4H5N3O1 C5H5N5 C14H15N13O2
AAA Lysine LYS K C5H5N5 C5H5N5 C5H5N5 C15H15N15O0
AAA Lysine LYS K C5H5N5 C5H5N5 C5H5N5 C15H15N15O0
AUU Isoleucine ILE I C5H5N5 C4H4N2O2 C4H4N2O2 C13H13N9O4
UGC Cysteine CYS C C4H4N2O2 C5H5N5O1 C4H5N3O1 C13H14N10O4
GUG Valine VAL V C5H5N5O1 C4H4N2O2 C5H5N5O1 C14H14N12O4
UUU Phenylalanine PHE F C4H4N2O2 C4H4N2O2 C4H4N2O2 C12H12N6O6
CCG Proline PRO P C4H5N3O1 C4H5N3O1 C5H5N5O1 C13H15N11O3
GUG Valine VAL V C5H5N5O1 C4H4N2O2 C5H5N5O1 C14H14N12O4
AAG Lysine LYS K C5H5N5 C5H5N5 C5H5N5O1 C15H15N15O1
CCU Proline PRO P C4H5N3O1 C4H5N3O1 C4H4N2O2 C12H14N8O4
ACA Threonine THR T C5H5N5 C4H5N3O1 C5H5N5 C14H15N13O1
AUC Isoleucine ILE I C5H5N5 C4H4N2O2 C4H5N3O1 C13H14N10O3
U






U






CCU Proline PRO P C4H5N3O1 C4H5N3O1 C4H4N2O2 C12H14N8O4
AUA Isoleucine ILE I C5H5N5 C4H4N2O2 C5H5N5 C14H14N12O2
UUU Phenylalanine PHE F C4H4N2O2 C4H4N2O2 C4H4N2O2 C12H12N6O6
GAG Glutamic acid GLU E C5H5N5O1 C5H5N5 C5H5N5O1 C15H15N15O2
AUU Isoleucine ILE I C5H5N5 C4H4N2O2 C4H4N2O2 C13H13N9O4
GUC Valine VAL V C5H5N5O1 C4H4N2O2 C4H5N3O1 C13H14N10O4
AUA Isoleucine ILE I C5H5N5 C4H4N2O2 C5H5N5 C14H14N12O2
GUC Valine VAL V C5H5N5O1 C4H4N2O2 C4H5N3O1 C13H14N10O4
GUG Valine VAL V C5H5N5O1 C4H4N2O2 C5H5N5O1 C14H14N12O4
GUU Valine VAL V C5H5N5O1 C4H4N2O2 C4H4N2O2 C13H13N9O5
AUC Isoleucine ILE I C5H5N5 C4H4N2O2 C4H5N3O1 C13H14N10O3
GAC Aspartic acid ASP D C5H5N5O1 C5H5N5 C4H5N3O1 C14H15N13O2
C






Appendix Omicron

This is an appendix to: On The Origin Of The Home Of COVID-19 - 29



Codons, Amino Acids and Chemical Formulas
Arranged By Order-of-appearance
In The Nucleotides of
VERSION: OM617939.1

Codon Amino Acid
('AA')
AA
Abbr.
AA
Ltr
Codon[1]
(formula)
Codon[2]
(formula)
Codon[3]
(formula)
Total Atoms
In Codon
AUG Methionine MET M C5H5N5 C4H4N2O2 C5H5N5O1 C14H14N12O3
CAU Histidine HIS H C4H5N3O1 C5H5N5 C4H4N2O2 C13H14N10O3
UUG Leucine LEU L C4H4N2O2 C4H4N2O2 C5H5N5O1 C13H13N9O5
CAU Histidine HIS H C4H5N3O1 C5H5N5 C4H4N2O2 C13H14N10O3
AGG Arginine ARG R C5H5N5 C5H5N5O1 C5H5N5O1 C15H15N15O2
CUG Leucine LEU L C4H5N3O1 C4H4N2O2 C5H5N5O1 C13H14N10O4
CUC Leucine LEU L C4H5N3O1 C4H4N2O2 C4H5N3O1 C12H14N8O4
UUG Leucine LEU L C4H4N2O2 C4H4N2O2 C5H5N5O1 C13H13N9O5
UAC Tyrosine TYR Y C4H4N2O2 C5H5N5 C4H5N3O1 C13H14N10O3
UCU Serine SER S C4H4N2O2 C4H5N3O1 C4H4N2O2 C12H13N7O5
CUC Leucine LEU L C4H5N3O1 C4H4N2O2 C4H5N3O1 C12H14N8O4
UUG Leucine LEU L C4H4N2O2 C4H4N2O2 C5H5N5O1 C13H13N9O5
CUG Leucine LEU L C4H5N3O1 C4H4N2O2 C5H5N5O1 C13H14N10O4
CUC Leucine LEU L C4H5N3O1 C4H4N2O2 C4H5N3O1 C12H14N8O4
CUG Leucine LEU L C4H5N3O1 C4H4N2O2 C5H5N5O1 C13H14N10O4
UAC Tyrosine TYR Y C4H4N2O2 C5H5N5 C4H5N3O1 C13H14N10O3
AGA Arginine ARG R C5H5N5 C5H5N5O1 C5H5N5 C15H15N15O1
AGG Arginine ARG R C5H5N5 C5H5N5O1 C5H5N5O1 C15H15N15O2
CUA Leucine LEU L C4H5N3O1 C4H4N2O2 C5H5N5 C13H14N10O3
AUG Methionine MET M C5H5N5 C4H4N2O2 C5H5N5O1 C14H14N12O3
UUA Leucine LEU L C4H4N2O2 C4H4N2O2 C5H5N5 C13H13N9O4
UCA Serine SER S C4H4N2O2 C4H5N3O1 C5H5N5 C13H14N10O3
UUG Leucine LEU L C4H4N2O2 C4H4N2O2 C5H5N5O1 C13H13N9O5
AUG Methionine MET M C5H5N5 C4H4N2O2 C5H5N5O1 C14H14N12O3
AUG Methionine MET M C5H5N5 C4H4N2O2 C5H5N5O1 C14H14N12O3
UCG Serine SER S C4H4N2O2 C4H5N3O1 C5H5N5O1 C13H14N10O4
AAC Asparagine ASN N C5H5N5 C5H5N5 C4H5N3O1 C14H15N13O1
UCG Serine SER S C4H4N2O2 C4H5N3O1 C5H5N5O1 C13H14N10O4
AUG Methionine MET M C5H5N5 C4H4N2O2 C5H5N5O1 C14H14N12O3
UUA Leucine LEU L C4H4N2O2 C4H4N2O2 C5H5N5 C13H13N9O4
AGU Serine SER S C5H5N5 C5H5N5O1 C4H4N2O2 C14H14N12O3
UAG Z_Stop STP Z C4H4N2O2 C5H5N5 C5H5N5O1 C14H14N12O3
UAC Tyrosine TYR Y C4H4N2O2 C5H5N5 C4H5N3O1 C13H14N10O3
UAC Tyrosine TYR Y C4H4N2O2 C5H5N5 C4H5N3O1 C13H14N10O3
UGA Z_Stop STP Z C4H4N2O2 C5H5N5O1 C5H5N5 C14H14N12O3
UUG Leucine LEU L C4H4N2O2 C4H4N2O2 C5H5N5O1 C13H13N9O5
UAG Z_Stop STP Z C4H4N2O2 C5H5N5 C5H5N5O1 C14H14N12O3

Appendix Wuhan

This is an appendix to: On The Origin Of The Home Of COVID-19 - 29



Codons, Amino Acids and Chemical Formulas
Arranged By Order-of-appearance
In The Nucleotides of
VERSION: NC_045512.2

Codon Amino Acid
('AA')
AA
Abbr.
AA
Ltr
Codon[1]
(formula)
Codon[2]
(formula)
Codon[3]
(formula)
Total Atoms
In Codon
AUG Methionine MET M C5H5N5 C4H4N2O2 C5H5N5O1 C14H14N12O3
CAU Histidine HIS H C4H5N3O1 C5H5N5 C4H4N2O2 C13H14N10O3
UUG Leucine LEU L C4H4N2O2 C4H4N2O2 C5H5N5O1 C13H13N9O5
CAU Histidine HIS H C4H5N3O1 C5H5N5 C4H4N2O2 C13H14N10O3
AGG Arginine ARG R C5H5N5 C5H5N5O1 C5H5N5O1 C15H15N15O2
CUG Leucine LEU L C4H5N3O1 C4H4N2O2 C5H5N5O1 C13H14N10O4
CUC Leucine LEU L C4H5N3O1 C4H4N2O2 C4H5N3O1 C12H14N8O4
UUG Leucine LEU L C4H4N2O2 C4H4N2O2 C5H5N5O1 C13H13N9O5
UAC Tyrosine TYR Y C4H4N2O2 C5H5N5 C4H5N3O1 C13H14N10O3
UCU Serine SER S C4H4N2O2 C4H5N3O1 C4H4N2O2 C12H13N7O5
CUC Leucine LEU L C4H5N3O1 C4H4N2O2 C4H5N3O1 C12H14N8O4
UUG Leucine LEU L C4H4N2O2 C4H4N2O2 C5H5N5O1 C13H13N9O5
CUG Leucine LEU L C4H5N3O1 C4H4N2O2 C5H5N5O1 C13H14N10O4
CUC Leucine LEU L C4H5N3O1 C4H4N2O2 C4H5N3O1 C12H14N8O4
CUG Leucine LEU L C4H5N3O1 C4H4N2O2 C5H5N5O1 C13H14N10O4
UAC Tyrosine TYR Y C4H4N2O2 C5H5N5 C4H5N3O1 C13H14N10O3
AGA Arginine ARG R C5H5N5 C5H5N5O1 C5H5N5 C15H15N15O1
AGG Arginine ARG R C5H5N5 C5H5N5O1 C5H5N5O1 C15H15N15O2
CUA Leucine LEU L C4H5N3O1 C4H4N2O2 C5H5N5 C13H14N10O3
AUG Methionine MET M C5H5N5 C4H4N2O2 C5H5N5O1 C14H14N12O3
UUA Leucine LEU L C4H4N2O2 C4H4N2O2 C5H5N5 C13H13N9O4
UCA Serine SER S C4H4N2O2 C4H5N3O1 C5H5N5 C13H14N10O3
UUG Leucine LEU L C4H4N2O2 C4H4N2O2 C5H5N5O1 C13H13N9O5
AUG Methionine MET M C5H5N5 C4H4N2O2 C5H5N5O1 C14H14N12O3
AUG Methionine MET M C5H5N5 C4H4N2O2 C5H5N5O1 C14H14N12O3
UCG Serine SER S C4H4N2O2 C4H5N3O1 C5H5N5O1 C13H14N10O4
AAC Asparagine ASN N C5H5N5 C5H5N5 C4H5N3O1 C14H15N13O1
UCG Serine SER S C4H4N2O2 C4H5N3O1 C5H5N5O1 C13H14N10O4
AUG Methionine MET M C5H5N5 C4H4N2O2 C5H5N5O1 C14H14N12O3
UUA Leucine LEU L C4H4N2O2 C4H4N2O2 C5H5N5 C13H13N9O4
AGU Serine SER S C5H5N5 C5H5N5O1 C4H4N2O2 C14H14N12O3
UAG Z_Stop STP Z C4H4N2O2 C5H5N5 C5H5N5O1 C14H14N12O3
UAC Tyrosine TYR Y C4H4N2O2 C5H5N5 C4H5N3O1 C13H14N10O3
UAC Tyrosine TYR Y C4H4N2O2 C5H5N5 C4H5N3O1 C13H14N10O3
UGA Z_Stop STP Z C4H4N2O2 C5H5N5O1 C5H5N5 C14H14N12O3
UUG Leucine LEU L C4H4N2O2 C4H4N2O2 C5H5N5O1 C13H13N9O5
UAG Z_Stop STP Z C4H4N2O2 C5H5N5 C5H5N5O1 C14H14N12O3