Wednesday, July 8, 2026

The Uncertain Gene - 12

It isn't alive
In a recent series it was noted that some genetic DNA of humans was found in 2-3 million year old eDNA in Greenland (Human DNA Found In 2-3 Mya eDNA?,  2).

It stimulated me to look into genetic DNA of ancient mummies of Egypt and Eurasia.

And elsewhere (The Origins of Human Beings According to Ancient Sumerian TextsAncient Humans Bred with Completely Unknown Species), Initial DNA analysis of Paracas elongated skull released – with incredible results).

There are gigabytes of files detailing sequences of that DNA.

So, I built a C++ program that parses the huge gigabyte files of nucleotides and first extracts tataboxes, then extracts mRNA sections from the tataboxes (see video below if you haven't already).

This is the process:

"When searching for sections of DNA in other DNA the software prepares the nucleotides so that partial segments can't be confused one for the other (see the example in the video below).

First you isolate a tatabox section by finding a promoter (TATAAA) and a terminator (TATCTC) segment:

TATAAAATGGCCGAGCGGTCTAAGGCGCTGC
GTTCAGGTCGCAGTCTCCCCTGGAGGCGTGG
GTTCGAATCCCACTCCTGATATCTCTATCTC 

Next erase the promoter and terminator from the string of nucleotides: 

ATGGCCGAGCGGTCTAAGGCGCTGC
GTTCAGGTCGCAGTCTCCCCTGGAGGCGTGG
GTTCGAATCCCACTCCTGA

Next, sequentially go thru the strand placing a '*' every third location

ATG*GCC*GAG*CGG*TCT*AAG*GCG*CTG*C
GT*TCA*GGT*CGC*AGT*CTC*CCC*TGG*AGG*CGT*GG
G*TTC*GAA*TCC*CAC*TCC*TGA

Then you look within that segment for a start codon (ATG) and one of three stop codons (TAA, TGA,TAG).

The ATG begins the transcription sequence, and the first (closest one following the start codon) instance of a stop codon ends the in-frame string of nucleotides. 

I do this to avoid what is described as an "out of frame" event that messes things up.

If there aren't three nucleotides separated by '*' then the strand is "not in-frame".

I store them in the SQL database with the '*' characters in place to preserve the proper arrangement. "

(Human DNA Found In 2-3 Mya eDNA?). Being extremely cautious avoids jumping "out of frame".

The overall process is to read all of the human DNA segments into one long string (millions of nucleotides), then load the Egyptian and Eurasian segments one at a time, searching the human string for each one.

The results are in Appendix One

The previous post in this series is here