Sunday, July 5, 2020

On The Origin Of The Home Of COVID-19 - 9

T4 backteriophage
I. Spooky

In the previous post I quoted from a researcher who pointed out that a virus in the dead flesh of a victim of the 1918 pandemic was reactivated in a lab circa 1997-98 (How long can viruses survive in a dead body?).

Some indicated that the dead flesh came from permafrost in the vast Alaska wilderness of that time, or in laboratories that had saved some of the flesh of victims here and there.

Wow, who woulda thunk it?

Other sources indicated that the viruses nucleotide sequence had been revealed, so I looked it up (The Deadliest Flu: The Complete Story of the Discovery and Reconstruction of the 1918 Pandemic Virus).

Not only that, I found a copy of the nucleotide sequence in fasta format, so, I just had to show it to Dredd Blog readers:

>gb: AF116575 | Organism: Influenza A virus (A / Brevig Mission / 1 / 1918(H1N1)) | Strain Name:A / Brevig Mission / 1/ 1918 | Segment:4 | Subtype:H1N1| Host: Human
ATGGAGGCAAGACTACTGGTCTTGTTATGTGCATTTGCAGCTACAAATGCAGACACAATATGTATAGGCT
ACCATGCGAATAACTCAACCGACACTGTTGACACAGTACTCGAAAAGAATGTGACCGTGACACACTCTGT
TAACCTGCTCGAAGACAGCCACAACGGAAAACTATGTAAATTAAAAGGAATAGCCCCATTACAATTGGGG
AAATGTAATATCGCCGGATGGCTCTTGGGAAACCCGGAATGCGATTTACTGCTCACAGCGAGCTCATGGT
CCTATATTGTAGAAACATCGAACTCAGAGAATGGAACATGTTACCCAGGAGATTTCATCGACTATGAAGA
ACTGAGGGAGCAATTGAGCTCAGTGTCATCGTTCGAAAAATTCGAAATATTTCCCAAGACAAGCTCGTGG
CCCAATCATGAAACAACCAAAGGTGTAACGGCAGCATGCTCCTATGCGGGAGCAAGCAGTTTTTACAGAA
ATTTGCTGTGGCTGACAAAGAAGGGAAGCTCATACCCAAAGCTTAGCAAGTCCTATGTGAACAATAAAGG
GAAAGAAGTCCTTGTACTATGGGGTGTTCATCATCCGCCTACCGGTACTGATCAACAGAGTCTCTATCAG
AATGCAGATGCTTATGTCTCTGTAGGGTCATCAAAATATAACAGGAGATTCACCCCGGAAATAGCAGCGA
GACCCAAAGTAAGAGATCAAGCTGGGAGGATGAACTATTACTGGACATTACTAGAACCCGGAGACACAAT
AACATTTGAGGCAACTGGAAATCTAATAGCACCATGGTATGCTTTCGCACTGAATAGAGGTTCTGGATCC
GGTATCATCACTTCAGACGCACCAGTGCATGATTGTAACACGAAGTGTCAAACACCCCATGGTGCTATAA
ACAGCAGTCTCCCTTTCCAGAATATACATCCAGTCACAATAGGAGAGTGCCCAAAATACGTCAGGAGTAC
CAAATTGAGGATGGCTACAGGACTAAGAAACATTCCATCTATTCAATCCAGGGGTCTATTTGGAGCCATT
GCCGGTTTTATTGAGGGGGGATGGACTGGAATGATAGATGGATGGTATGGTTATCATCATCAGAATGAAC
AGGGATCAGGCTATGCAGCGGATCAAAAAAGCACACAAAATGCCATTGACGGGATTACAAACAAGGTGAA
TTCTGTTATCGAGAAAATGAACACCCAATT

(Genome of the 1918 Pandemic causing virus, bold added). Having done that I decided to search for matches of genome segments of that virus in cow rumen.

The process is to search for a 10 segment sequence (the bold at the beginning of the sequence above shows the first one) of that 1918 pandemic virus.

It is the same process I had used with Sars-CoV-2 in cow rumen, poultry, swine, and bats (On The Origin Of The Home Of COVID-19, 2, 3, 4, 5, 6, 7, 8).

The bold section of ten bases is searched for first, a count is kept, then we move to the next ten bases, and so forth, keeping a tally as shown in Section II below.

The purpose is to see if any segments of that 1918 virus are in our current 'virusphere'.

If so, then we are talking about reassortment/recombinant viruses (RNA Virus Reassortment, Recombinant).

II. Searchin' Searchin' Searchin'

My software module searched hundreds of thousands of cow rumen nucleotide/genome datasets in files in the GenBank, and reported:

1918 Virus Bases ID: AF116575
(Organism: Influenza A virus
A/Brevig Mission/1/1918
Strain Name: A/Brevig Mission/1/1918
Host: Human virus type: H1N1)

Target bases to search:
Cow Rumen

Comparison Type:
1918 Virus segment = Rumen segment?

Search Results:

GenBank
File Id
Segments in
1918 Virus
Genomes in
Rumen File
1918 Virus Segments
Found in Genomes
1918 Segments
per Genome
10676_0040 122 295,166 10,983 26.8748
10676_0039 122 128,519 6,266 20.5105
10676_0010 122 787 855 0.920468
10676_0003 122 1,088 937 1.16115
10676_0011 122 176 282 0.624113
10676_0036 122 6,630 2,553 2.59694
10676_0046 122 42,643 5,391 7.91004
10676_0012 122 296 473 0.625793
10676_0022 122 87 186 0.467742
10676_0038 122 364,399 13,241 27.5205
10676_0049 122 64,980 6,150 10.5659
10676_0045 122 187,633 8592 21.8381
10676_0005 122 220,342 8,575 25.6959
10676_0037 122 117,147 7,505 15.6092
10676_0015 122 568 700 0.811429
10676_0002 122 245 424 0.57783
10676_0030 122 1,793 1,264 1.41851
10676_0041 122 53,535 5,979 8.95384
10676_0009 122 355,497 14,134 25.1519
10676_0019 122 138,641 6,497 21.3392
10676_0051 122 44,327 5,808 7.63206
10676_0029 122 7,539 2,376 3.17298
10676_0028 122 2,366 1,770 1.33672
10676_0018 122 9,976 3,092 3.22639
10676_0042 122 66,725 6,840 9.75512
10676_0021 122 437 627 0.69697
10676_0032 122 15,691 4,193 3.74219
10676_0013 122 192,309 9,732 19.7605
10676_0035 122 1,408 1,054 1.33586
10676_0001 122 119 215 0.553488
10676_0034 122 1,091 986 1.10649
10676_0004 122 772 827 0.933495
10676_0023 122 320,673 11,944 26.848
10676_0050 122 121,778 6,336 19.22
10676_0033 122 33,440 5,181 6.45435
10676_0014 122 230,170 9,615 23.9386
10676_0006 122 1,662 1,311 1.26773
10676_0024 122 405,094 14,710 27.5387
10676_0025 122 2,617 1,618 1.61743
10676_0048 122 38,609 6,462 5.97478
10676_0016 122 144,629 6,531 22.145
10676_0020 122 3,295 1,720 1.9157
10676_0031 122 36,897 4,728 7.80393
10676_0047 122 118,461 6,913 17.136
10676_0043 122 45,438 5,880 7.72755
10676_0027 122 103,080 5,830 17.681
10676_0017 122 10,564 2,882 3.66551

Per-file Average (47 files):

Genomes in Rumen File: 83,815.7
1918 Virus Segments Found in Genomes: 4,897.19
1918 Segments per Genome: 9.90128

III. Closing Comments

That report in Section II above is a perusal of a vast amount of data freely available at GenBank.

It is quite a story that a century-old virus could be reactivated, then put through the paces so that the genome could be captured for further scientific use.

And, so that Dredd Blog could go looking for it with modern software in the rumen of modern cattle.

A quote from one researcher caught my eye:

"The lessons we're learning today from COVID-19 build on the lessons we learned from the 1918 influenza. We aren't the apex predator we think we are. An organism 750 times smaller than the width of human hair can wreak havoc on us to rival most wars..."

(How long can viruses survive in a dead body?, bold added). The Sars-CoV-2 that causes COVID-19 has already rivaled WW1 and two Vietnam's.

The count in those wars took years to accumulate, in the case of Vietnam ten years.

This COVID-19 war-like landscape of dead bodies has only begun.

It is halfway through its first year.

The previous post in this series is here.

Tuesday, June 30, 2020

On The Origin Of The Home Of COVID-19 - 8

Safety in numbers?
I. Background

In the first post of this series I pointed out almost a decade of Dredd Blog posts that agree with the recent hypotheses of The Guardian.

There are others who think outside the box and are willing to investigate every potential (New research suggests industrial livestock, not wet markets, might be origin of Covid-19).

I also disagreed with a former Monsanto alumni who disagreed with The Guardian article, but provided nothing of substance to rebut the hypothesis (On The Origin Of The Home Of COVID-19).

Thereafter, I downloaded many gigabytes of nucleic acid sequences/nucleobases that detailed characteristics of SARS-CoV-2 which I compared to various potential origins of that virus in cows and bats.

I have now completed a search for the same human SARS-CoV-2 virus segments in poultry (gallus gallus domesticus) and swine (porcine).

These results, as did the previous results, indicate that cows, chickens, and pigs have more nucleobase/nucleic acid segments of human SARS-CoV-2 than bats do (On The Origin Of The Home Of COVID-19, 2, 3, 4, 5, 6, 7).

This does substantiate The Guardian suspicions as well as my own, however, more is needed to verify this hypothesis.

II. More Nucleobase/Nucleic Acid Sequence Searches

In the table below the "MT641485.1 SARS-CoV-2 human virus (Covid-19)" specimen (also used in the bat and cow tests) was segmented 10 bases at a time, then that segment was searched for in Porcine (pig) and Gallus gallus (chicken) nucleobases/nucleic acid sequences (as was done for cow rumen and bat nucleobase/nucleic acid sequences in earlier posts).

The far right column of the table ("Sars-Cov-2 Segment Count") is a count of how many of the "MT641485.1 SARS-CoV-2 human virus (Covid-19)" segments were found in the pig and chicken nucleobase/nucleic acid sequences.

The percentage is much higher than the percentage results from the bat search, but a little less than the search through cow rumen nucleobase/nucleic acid sequences.

The results of the Porcine/Gallus gallus search:


Covid Bases ID: MT641485.1
(sars coronavirus 2 isolate
SARS-CoV-2 human USA WA-S709 2020
complete genome virus type: SC-HS-CG-DN)
Target bases to search: Porcine & Gallus gallus
Comparison Type:
SARS-Cov-2 segment = Porcine or Gallus segment?
Search Results:
Porcine/Gallus
File Section Id
Porcine/Gallus
Virus Type
Porcine
or Poultry
Sars-Cov-2
Segment Count
DQ377140 CO-AN-CC-RN Poultry 0
AY839137 CO-AN-CC-DN Poultry 0
DQ355924 CO-AN-CC-DN Poultry 0
DQ472165 CO-AN-CC-RN Poultry 0
EU200779 CO-AN-CC-DN Poultry 1
AF298213 CO-AN-CC-RN Porcine 0
AF179888 CO-AN-CC-DN Porcine 0
EU889030 CO-AN-CC-DN Poultry 0
EU526388 CO-AN-CG-DN Poultry 205
EU999786 CO-AN-CC-DN Porcine 0
EU714029 CO-AN-CG-DN Poultry 209
AY839141 CO-AN-CC-DN Poultry 1
EU817497 CO-AN-CG-DN Poultry 194
DQ011855 CO-AN-CG-DN Porcine 262
EU930436 CO-AN-CC-DN Poultry 0
EU889032 CO-AN-CC-DN Poultry 1
AY842867 CO-AN-CC-DN Poultry 0
DQ377139 CO-AN-CC-RN Poultry 0
AF179886 CO-AN-CC-DN Porcine 0
DQ068701 CO-AN-CC-DN Poultry 3
DQ377138 CO-AN-CC-RN Poultry 0
AY842868 CO-AN-CC-DN Poultry 0
AF179889 CO-AN-CC-DN Porcine 0
DQ472167 CO-AN-CC-RN Poultry 0
AY842864 CO-AN-CC-DN Poultry 0
DQ355923 CO-AN-CC-DN Poultry 0
EU919227 CO-AN-CC-DN Porcine 3
AY078417 CO-AN-CC-DN Porcine 17
AF302264 CO-AN-CC-RN Porcine 0
AF302262 CO-AN-CC-RN Porcine 1
DQ472166 CO-AN-CC-RN Poultry 0
EU930435 CO-AN-CC-DN Poultry 0
EU889031 CO-AN-CC-DN Poultry 0
EU812232 CO-AN-CC-DN Poultry 2
AF481863 CO-AN-CC-DN Porcine 17
AY839136 CO-AN-CC-DN Poultry 1
AF179887 CO-AN-CC-DN Porcine 0
AY842863 CO-AN-CC-DN Poultry 1
DQ472168 CO-AN-CC-RN Poultry 0
EU714034 CO-AN-CC-RN Poultry 1
EF213582 CO-AN-CC-DN Poultry 0
EU930437 CO-AN-CC-DN Poultry 1
AF104420 CO-AN-CC-RN Porcine 22
DQ084440 CO-AN-CC-DN Poultry 0
AF302263 CO-AN-CC-RN Porcine 3
AY839143 CO-AN-CC-DN Poultry 0
DQ377141 CO-AN-CC-RN Poultry 0
EU714028 CO-AN-CG-DN Poultry 206
FJ767918 CO-AN-CC-DN Poultry 0
GQ844996 CO-AN-CC-DN Poultry 0
FJ904719 CO-AN-CG-DN Poultry 199
HM230752 CO-AN-CC-DN Poultry 0
JQ964064 CO-AN-CC-DN Poultry 0
JX014373 CO-AN-CC-DN Poultry 0
JQ231285 CO-AN-CC-DN Poultry 0
JF732903 CO-AN-CG-DN Poultry 193
JX273197 CO-AN-CC-DN Poultry 1
FJ767926 CO-AN-CC-DN Poultry 0
JQ660962 CO-AN-CC-DN Poultry 4
FJ965348 CO-AN-CC-DN Poultry 1
JQ231283 CO-AN-CC-DN Poultry 0
JX273221 CO-AN-CC-DN Poultry 0
JQ231288 CO-AN-CC-DN Poultry 0
FJ965347 CO-AN-CC-DN Poultry 1
FJ767934 CO-AN-CC-DN Poultry 0
HQ141069 CO-AN-CC-DN Poultry 0
FJ849835 CO-AN-CC-DN Poultry 0
GQ853591 CO-AN-CC-RN Poultry 0
FJ767917 CO-AN-CC-DN Poultry 0
FJ589732 CO-AN-CC-DN Poultry 0
FJ849812 CO-AN-CC-DN Poultry 0
JF951370 CO-AN-CU-RN Poultry 0
FJ849807 CO-AN-CC-DN Poultry 1
HQ141058 CO-AN-CC-DN Poultry 1
FJ829881 CO-AN-CC-DN Poultry 0
FJ767933 CO-AN-CC-DN Poultry 1
JX273185 CO-AN-CC-DN Poultry 0
GQ174481 CO-AN-CC-DN Poultry 0
JN022547 CO-AN-CC-DN Poultry 2
GQ227602 CO-AN-CC-DN Poultry 1
FJ829878 CO-AN-CC-DN Poultry 0
GQ504724 CO-AN-CG-DN Poultry 187
FJ767922 CO-AN-CC-DN Poultry 1
JX014372 CO-AN-CC-DN Poultry 0
FJ849826 CO-AN-CC-DN Poultry 1
FJ849805 CO-AN-CC-DN Poultry 1
GQ844995 CO-AN-CC-DN Poultry 0
HM230750 CO-AN-CC-DN Poultry 0
JQ964084 CO-AN-CC-DN Poultry 0
FJ904714 CO-AN-CG-DN Poultry 179
HM159259 CO-AN-CC-DN Poultry 1
JF738086 CO-AN-CC-DN Poultry 0
HM159257 CO-AN-CC-DN Poultry 0
JX569792 CO-AN-CC-DN Poultry 0
JN022552 CO-AN-CC-DN Poultry 3
HQ283475 CO-AN-CC-DN Poultry 1
FJ821771 CO-AN-CC-DN Poultry 1
JX565011 CO-AN-CC-DN Poultry 1
FJ965345 CO-AN-CC-DN Poultry 0
HQ141074 CO-AN-CC-DN Poultry 0
FJ849808 CO-AN-CC-DN Poultry 1
JQ693040 CO-AN-CC-DN Poultry 1
JF951369 CO-AN-CU-RN Poultry 1
JQ693038 CO-AN-CC-DN Poultry 1
JX273193 CO-AN-CC-DN Poultry 0
JX273184 CO-AN-CC-DN Poultry 0
JQ964083 CO-AN-CC-DN Poultry 0
HM230751 CO-AN-CC-DN Poultry 0
GQ174473 CO-AN-CC-DN Poultry 0
FJ767913 CO-AN-CC-DN Poultry 1
FJ965346 CO-AN-CC-DN Poultry 1
FJ821762 CO-AN-CC-DN Poultry 0
FJ849819 CO-AN-CC-DN Poultry 0
JX273191 CO-AN-CC-DN Poultry 0
JX273190 CO-AN-CC-DN Poultry 0
HQ141072 CO-AN-CC-DN Poultry 0
JX014374 CO-AN-CC-DN Poultry 0
JX273198 CO-AN-CC-DN Poultry 1
JX273179 CO-AN-CC-DN Poultry 0
FJ849804 CO-AN-CC-DN Poultry 0
JX273214 CO-AN-CC-DN Poultry 0
JX565014 CO-AN-CC-DN Poultry 1
FJ849801 CO-AN-CC-DN Poultry 0
JX195176 CO-AN-CG-DN Poultry 199
FJ849820 CO-AN-CC-DN Poultry 0
JX273211 CO-AN-CC-DN Poultry 1
FJ589730 CO-AN-CC-DN Poultry 0
HQ141068 CO-AN-CC-DN Poultry 0
FJ849803 CO-AN-CC-DN Poultry 0
FJ849823 CO-AN-CC-DN Poultry 0
FJ767914 CO-AN-CC-DN Poultry 1
FJ829879 CO-AN-CC-DN Poultry 1
GU393334 CO-AN-CG-DN Poultry 189
HQ141063 CO-AN-CC-DN Poultry 0
GQ504721 CO-AN-CG-DN Poultry 189
JF732918 CO-AN-CC-DN Poultry 15
FJ821772 CO-AN-CC-DN Poultry 1
JN022548 CO-AN-CC-DN Poultry 2
JQ693039 CO-AN-CC-DN Poultry 1
GQ174478 CO-AN-CC-DN Poultry 1
GQ844999 CO-AN-CC-DN Poultry 1
FJ430687 CO-AN-CC-DN Poultry 0
JX273210 CO-AN-CC-DN Poultry 1
FJ849809 CO-AN-CC-DN Poultry 1
GQ174485 CO-AN-CC-DN Poultry 1
HQ141065 CO-AN-CC-DN Poultry 0
JQ964081 CO-AN-CC-DN Poultry 0
JQ693041 CO-AN-CC-DN Poultry 0
FJ849824 CO-AN-CC-DN Poultry 1
FJ849825 CO-AN-CC-DN Poultry 1
FJ829876 CO-AN-CC-DN Poultry 1
HQ607365 CO-AN-CC-RN Poultry 0
FJ821773 CO-AN-CC-DN Poultry 0
JQ977698 CO-AN-CG-DN Poultry 196
JX273223 CO-AN-CC-DN Poultry 1
HQ141059 CO-AN-CC-DN Poultry 0
JN022539 CO-AN-CC-DN Poultry 2
FJ821764 CO-AN-CC-DN Poultry 0
GU393336 CO-AN-CG-DN Poultry 207
JQ660960 CO-AN-CC-DN Poultry 3
JQ065043 CO-AN-CG-DN Porcine 120
HM159262 CO-AN-CC-DN Poultry 0
JQ693043 CO-AN-CC-DN Poultry 0
JX273207 CO-AN-CC-DN Poultry 1
FJ829872 CO-AN-CC-DN Poultry 0
FJ849798 CO-AN-CC-DN Poultry 0
HM245924 CO-AN-CG-DN Poultry 195
JX255512 CO-AN-CC-DN Poultry 1
JX273195 CO-AN-CC-DN Poultry 0
FJ904717 CO-AN-CG-DN Poultry 200
JQ660957 CO-AN-CC-DN Poultry 3
FJ821736 CO-AN-CC-DN Poultry 0
JX273177 CO-AN-CC-DN Poultry 0
JX273180 CO-AN-CC-DN Poultry 0
FJ821745 CO-AN-CC-DN Poultry 0
FJ821770 CO-AN-CC-DN Poultry 1
JF730309 CO-AN-CC-DN Poultry 1
FJ767921 CO-AN-CC-DN Poultry 0
FJ589731 CO-AN-CC-DN Poultry 0
JX853709 CO-AN-CC-DN Poultry 1
JX014366 CO-AN-CC-DN Poultry 0
HM159258 CO-AN-CC-DN Poultry 0
JN022544 CO-AN-CC-DN Poultry 1
FJ849829 CO-AN-CC-DN Poultry 0
GQ174474 CO-AN-CC-DN Poultry 1
JX273206 CO-AN-CC-DN Poultry 0
FJ009234 CO-AN-CC-DN Porcine 0
JQ693045 CO-AN-CC-DN Poultry 0
JX273204 CO-AN-CC-DN Poultry 0
HM159256 CO-AN-CC-DN Poultry 0
GQ227603 CO-AN-CC-DN Poultry 1
FJ430686 CO-AN-CC-DN Poultry 0
FJ965344 CO-AN-CC-DN Poultry 0
FJ849811 CO-AN-CC-DN Poultry 0
JX273212 CO-AN-CC-DN Poultry 1
JN022545 CO-AN-CC-DN Poultry 2
HQ141073 CO-AN-CC-DN Poultry 0
JQ660958 CO-AN-CC-DN Poultry 4
JQ088078 CO-AN-CG-DN Poultry 193
JX273205 CO-AN-CC-DN Poultry 0
GU393331 CO-AN-CG-DN Poultry 182
GU391029 CO-AN-CC-DN Poultry 0
GU386375 CO-AN-CC-DN Poultry 14
JX014375 CO-AN-CC-DN Poultry 0
JQ660959 CO-AN-CC-DN Poultry 4
JN022537 CO-AN-CC-DN Poultry 1
JX565010 CO-AN-CC-DN Poultry 0
HQ850618 CO-AN-CG-DN Poultry 182
JQ660961 CO-AN-CC-DN Poultry 4
JF951368 CO-AN-CU-RN Poultry 0
JQ693035 CO-AN-CC-DN Poultry 1
FJ746554 CO-AN-CC-RN Poultry 0
JN022550 CO-AN-CC-DN Poultry 2
FJ829883 CO-AN-CC-DN Poultry 1
JX273186 CO-AN-CC-DN Poultry 0
JF738089 CO-AN-CC-DN Poultry 0
JF828981 CO-AN-CG-DN Poultry 205
FJ849802 CO-AN-CC-DN Poultry 0
JX195177 CO-AN-CG-DN Poultry 197
JF738087 CO-AN-CC-DN Poultry 0
FJ849817 CO-AN-CC-DN Poultry 0
JQ964073 CO-AN-CC-DN Poultry 0
FJ849827 CO-AN-CC-DN Poultry 1
HQ607366 CO-AN-CC-RN Poultry 0
JN022555 CO-AN-CC-DN Poultry 1
JX273194 CO-AN-CC-DN Poultry 0
JX273187 CO-AN-CC-DN Poultry 0
FJ821768 CO-AN-CC-DN Poultry 0
GQ174484 CO-AN-CC-DN Poultry 1
JX273225 CO-AN-CC-DN Poultry 1
JX273218 CO-AN-CC-DN Poultry 1
HQ141062 CO-AN-CC-DN Poultry 0
JX840411 CO-AN-CG-DN Poultry 192
JN022546 CO-AN-CC-DN Poultry 2
FJ904715 CO-AN-CG-DN Poultry 199
JF738088 CO-AN-CC-DN Poultry 1
JF951374 CO-AN-CU-RN Poultry 0
FJ919612 CO-AN-CC-DN Poultry 0
FJ849814 CO-AN-CC-DN Poultry 0
GQ504720 CO-AN-CG-DN Poultry 195
GQ844993 CO-AN-CC-DN Poultry 0
JQ964076 CO-AN-CC-DN Poultry 0
JN022553 CO-AN-CC-DN Poultry 2
GU393333 CO-AN-CG-DN Poultry 198
FJ821767 CO-AN-CC-DN Poultry 0
FJ821732 CO-AN-CC-DN Poultry 0
HQ141067 CO-AN-CC-DN Poultry 0
FJ687159 CO-AN-CC-RN Poultry 0
JQ964082 CO-AN-CC-DN Poultry 0
JX273199 CO-AN-CC-DN Poultry 0
GQ504723 CO-AN-CG-DN Poultry 184
JX273188 CO-AN-CC-DN Poultry 0
JX273183 CO-AN-CC-DN Poultry 0
JX273226 CO-AN-CC-DN Poultry 1
JF330899 CO-AN-CG-DN Poultry 208
FJ767924 CO-AN-CC-DN Poultry 0
FJ888351 CO-AN-CG-DN Poultry 205
JX273189 CO-AN-CC-DN Poultry 0
JF951377 CO-AN-CU-RN Poultry 0
JN022536 CO-AN-CC-DN Poultry 1
JQ065042 CO-AN-CG-DN Porcine 125
JF951372 CO-AN-CU-RN Poultry 0
GQ149079 CO-AN-CC-DN Poultry 0
JX273178 CO-AN-CC-DN Poultry 0
FJ849830 CO-AN-CC-DN Poultry 0
JX273216 CO-AN-CC-DN Poultry 1
GQ844998 CO-AN-CC-DN Poultry 0
FJ767916 CO-AN-CC-DN Poultry 0
JX273228 CO-AN-CC-DN Poultry 0
JN022543 CO-AN-CC-DN Poultry 1
JX014367 CO-AN-CC-DN Poultry 0
GQ174486 CO-AN-CC-DN Poultry 1
HQ014605 CO-AN-CC-DN Poultry 0
FJ430685 CO-AN-CC-DN Poultry 0
GU393338 CO-AN-CG-DN Poultry 183
FJ965349 CO-AN-CC-DN Poultry 1
JN022551 CO-AN-CC-DN Poultry 3
GQ504722 CO-AN-CG-DN Poultry 178
JF951373 CO-AN-CU-RN Poultry 0
JQ231289 CO-AN-CC-DN Poultry 0
HQ014604 CO-AN-CC-DN Poultry 0
FJ849810 CO-AN-CC-DN Poultry 0
GQ844997 CO-AN-CC-DN Poultry 0
JN022538 CO-AN-CC-DN Poultry 1
JN022554 CO-AN-CC-DN Poultry 2
HQ141070 CO-AN-CC-DN Poultry 0
FJ430689 CO-AN-CC-DN Poultry 0
JX273224 CO-AN-CC-DN Poultry 1
FJ821747 CO-AN-CC-DN Poultry 0
HQ141066 CO-AN-CC-DN Poultry 0
JQ693046 CO-AN-CC-DN Poultry 1
JQ964077 CO-AN-CC-DN Poultry 0
JX273217 CO-AN-CC-DN Poultry 1
FJ849796 CO-AN-CC-DN Poultry 1
HM245923 CO-AN-CG-DN Poultry 201
JQ964075 CO-AN-CC-DN Poultry 0
FJ821743 CO-AN-CC-DN Poultry 0
FJ849800 CO-AN-CC-DN Poultry 1
FJ793943 CO-AN-CC-RN Poultry 0
JQ801377 CO-AN-CC-DN Poultry 1
FJ904723 CO-AN-CG-DN Poultry 186
FJ849831 CO-AN-CC-DN Poultry 1
FJ821748 CO-AN-CC-DN Poultry 0
FJ849834 CO-AN-CC-DN Poultry 1
GQ174475 CO-AN-CC-DN Poultry 1
FJ904722 CO-AN-CG-DN Poultry 194
FJ767925 CO-AN-CC-DN Poultry 0
JQ977697 CO-AN-CG-DN Poultry 196
JX273227 CO-AN-CC-DN Poultry 1
FJ919617 CO-AN-CC-DN Poultry 1
GQ174483 CO-AN-CC-DN Poultry 1
JQ660955 CO-AN-CC-DN Poultry 3
JX565012 CO-AN-CC-DN Poultry 1
JX273182 CO-AN-CC-DN Poultry 0
FJ904721 CO-AN-CG-DN Poultry 191
JX195178 CO-AN-CG-DN Poultry 195
FJ767932 CO-AN-CC-DN Poultry 1
JQ693036 CO-AN-CC-DN Poultry 1
JX273220 CO-AN-CC-DN Poultry 1
FJ821741 CO-AN-CC-DN Poultry 0
JF893452 CO-AN-CG-DN Poultry 220
FJ829875 CO-AN-CC-DN Poultry 0
FJ821763 CO-AN-CC-DN Poultry 0
FJ793944 CO-AN-CC-RN Poultry 0
GQ149078 CO-AN-CC-DN Poultry 0
JX273219 CO-AN-CC-DN Poultry 0
JF951376 CO-AN-CU-RN Poultry 0
FJ767928 CO-AN-CC-DN Poultry 0
FJ829874 CO-AN-CC-DN Poultry 1
JX273215 CO-AN-CC-DN Poultry 1
FJ821737 CO-AN-CC-DN Poultry 0
JX014370 CO-AN-CC-DN Poultry 0
GQ174480 CO-AN-CC-DN Poultry 0
JX897900 CO-AN-CG-DN Poultry 181
JQ231287 CO-AN-CC-DN Poultry 0
JX565015 CO-AN-CC-DN Poultry 1
FJ849815 CO-AN-CC-DN Poultry 0
FJ904720 CO-AN-CG-DN Poultry 186
JX273203 CO-AN-CC-DN Poultry 1
FJ767931 CO-AN-CC-DN Poultry 0
FJ767920 CO-AN-CC-DN Poultry 0
JX273196 CO-AN-CC-DN Poultry 0
HQ141061 CO-AN-CC-DN Poultry 0
FJ009232 CO-AN-CC-DN Porcine 0
FJ821744 CO-AN-CC-DN Poultry 0
FJ849828 CO-AN-CC-DN Poultry 0
FJ919614 CO-AN-CC-DN Poultry 0
FJ009233 CO-AN-CC-DN Porcine 0
JF274479 CO-AN-CG-DN Poultry 192
JX273200 CO-AN-CC-DN Poultry 1
JQ964079 CO-AN-CC-DN Poultry 0
JX273208 CO-AN-CC-DN Poultry 1
FJ589733 CO-AN-CC-DN Poultry 0
FJ829880 CO-AN-CC-DN Poultry 1
FJ821761 CO-AN-CC-DN Poultry 0
FJ821765 CO-AN-CC-DN Poultry 0
JX273201 CO-AN-CC-DN Poultry 1
JQ693047 CO-AN-CC-DN Poultry 0
FJ746556 CO-AN-CC-RN Poultry 0
FJ919613 CO-AN-CC-DN Poultry 1
GQ174482 CO-AN-CC-DN Poultry 1
FJ904716 CO-AN-CG-DN Poultry 199
FJ829873 CO-AN-CC-DN Poultry 0
FJ829877 CO-AN-CC-DN Poultry 0
JQ964078 CO-AN-CC-DN Poultry 0
JQ693037 CO-AN-CC-DN Poultry 1
JX273192 CO-AN-CC-DN Poultry 0
HM159261 CO-AN-CC-DN Poultry 0
FJ849818 CO-AN-CC-DN Poultry 0
JQ693044 CO-AN-CC-DN Poultry 0
FJ821746 CO-AN-CC-DN Poultry 0
FJ849821 CO-AN-CC-DN Poultry 1
FJ767915 CO-AN-CC-DN Poultry 0
JN022549 CO-AN-CC-DN Poultry 2
FJ849799 CO-AN-CC-DN Poultry 0
FJ849797 CO-AN-CC-DN Poultry 1
FJ793942 CO-AN-CC-RN Poultry 0
FJ849806 CO-AN-CC-DN Poultry 0
GU393332 CO-AN-CG-DN Poultry 198
HQ141060 CO-AN-CC-DN Poultry 0
JQ660956 CO-AN-CC-DN Poultry 3
FJ849833 CO-AN-CC-DN Poultry 0
JN022541 CO-AN-CC-DN Poultry 1
JF951375 CO-AN-CU-RN Poultry 0
FJ849813 CO-AN-CC-DN Poultry 0
FJ821766 CO-AN-CC-DN Poultry 0
GQ179645 CO-AN-CC-DN Poultry 1
JQ964080 CO-AN-CC-DN Poultry 0
FJ746555 CO-AN-CC-RN Poultry 0
JX565013 CO-AN-CC-DN Poultry 1
JX014369 CO-AN-CC-DN Poultry 0
JX273181 CO-AN-CC-DN Poultry 0
FJ767927 CO-AN-CC-DN Poultry 0
GQ853592 CO-AN-CC-RN Poultry 0
HQ848267 CO-AN-CG-DN Poultry 201
JQ693034 CO-AN-CC-DN Poultry 1
JX273213 CO-AN-CC-DN Poultry 1
GQ844994 CO-AN-CC-DN Poultry 1
FJ849822 CO-AN-CC-DN Poultry 1
JX273222 CO-AN-CC-DN Poultry 1
HQ141064 CO-AN-CC-DN Poultry 0
FJ849816 CO-AN-CC-DN Poultry 0
GU393337 CO-AN-CG-DN Poultry 209
JQ964074 CO-AN-CC-DN Poultry 0
FJ829882 CO-AN-CC-DN Poultry 1
FJ919616 CO-AN-CC-DN Poultry 1
FJ767929 CO-AN-CC-DN Poultry 0
JF951371 CO-AN-CU-RN Poultry 0
FJ821769 CO-AN-CC-DN Poultry 1
JN022540 CO-AN-CC-DN Poultry 1
HM159263 CO-AN-CC-DN Poultry 0
HQ141071 CO-AN-CC-DN Poultry 0
JF330898 CO-AN-CG-DN Poultry 197
JX273176 CO-AN-CC-DN Poultry 0
FJ821738 CO-AN-CC-DN Poultry 0
JQ231284 CO-AN-CC-DN Poultry 0
GQ174479 CO-AN-CC-DN Poultry 1
GQ504725 CO-AN-CG-DN Poultry 131
GU393335 CO-AN-CG-DN Poultry 203
JF951367 CO-AN-CU-RN Poultry 0
FJ821742 CO-AN-CC-DN Poultry 0
HM159260 CO-AN-CC-DN Poultry 0
FJ821740 CO-AN-CC-DN Poultry 0
GQ845000 CO-AN-CC-DN Poultry 0
FJ767919 CO-AN-CC-DN Poultry 1
JX273202 CO-AN-CC-DN Poultry 1
JX273209 CO-AN-CC-DN Poultry 0
FJ904718 CO-AN-CG-DN Poultry 199
JQ231281 CO-AN-CC-DN Poultry 0
GQ229232 CO-AN-CC-DN Poultry 8
JN022542 CO-AN-CC-DN Poultry 1
GQ174477 CO-AN-CC-DN Poultry 1
GQ174476 CO-AN-CC-DN Poultry 1
JQ693048 CO-AN-CC-DN Poultry 4
JF828980 CO-AN-CG-DN Poultry 188
FJ849832 CO-AN-CC-DN Poultry 0
FJ919615 CO-AN-CC-DN Poultry 1
JQ693042 CO-AN-CC-DN Poultry 0
JX014368 CO-AN-CC-DN Poultry 0
JX195175 CO-AN-CG-DN Poultry 195
FJ767923 CO-AN-CC-DN Poultry 0
FJ821739 CO-AN-CC-DN Poultry 0
JX273229 CO-AN-CC-DN Poultry 0
FJ770461 CO-AN-CC-DN Poultry 0
FJ904713 CO-AN-CG-DN Poultry 196
FJ767930 CO-AN-CC-DN Poultry 1
JX014371 CO-AN-CC-DN Poultry 0
KF975408 CO-AN-CC-DN Poultry 0
KF996274 CO-AN-CC-DN Poultry 0
KJ425507 CO-AN-CG-DN Poultry 206
KJ425502 CO-AN-CG-DN Poultry 205
KM279006 CO-AN-CC-DN Poultry 0
KM279009 CO-AN-CC-DN Poultry 0
KJ872789 CO-AN-CC-DN Poultry 0
KF931628 CO-AN-CG-DN Poultry 204
KJ940503 CO-AN-CC-DN Poultry 1
KJ469740 CO-AN-CC-DN Poultry 3
KC478653 CO-AN-CC-DN Poultry 0
KM279001 CO-AN-CC-DN Poultry 0
KC506155 CO-AN-CG-DN Poultry 200
KF996278 CO-AN-CC-DN Poultry 0
KM278998 CO-AN-CC-DN Poultry 0
KJ425501 CO-AN-CG-DN Poultry 205
KJ872794 CO-AN-CC-DN Poultry 0
KJ435283 CO-AN-CG-DN Poultry 199
KJ425506 CO-AN-CG-DN Poultry 206
KJ425495 CO-AN-CG-DN Poultry 209
KF460437 CO-AN-CG-DN Poultry 204
KF996281 CO-AN-CC-DN Poultry 0
KJ940545 CO-AN-CC-DN Poultry 0
KJ469746 CO-AN-CC-DN Poultry 3
KF996285 CO-AN-CC-DN Poultry 0
KJ872793 CO-AN-CC-DN Poultry 0
KJ940538 CO-AN-CC-DN Poultry 0
KJ940497 CO-AN-CC-DN Poultry 0
KJ425497 CO-AN-CG-DN Poultry 212
KJ940508 CO-AN-CC-DN Poultry 0
KF996282 CO-AN-CC-DN Poultry 0
KJ940537 CO-AN-CC-DN Poultry 0
KJ469747 CO-AN-CC-DN Poultry 0
KJ425489 CO-AN-CG-DN Poultry 206
KF188434 CO-AN-CC-DN Poultry 1
KC008600 CO-AN-CG-DN Poultry 186
KJ872783 CO-AN-CC-DN Poultry 0
KJ940517 CO-AN-CC-DN Poultry 0
KC478650 CO-AN-CC-DN Poultry 0
KJ940543 CO-AN-CC-DN Poultry 0
KJ425490 CO-AN-CG-DN Poultry 206
KF996273 CO-AN-CC-DN Poultry 0
KF975405 CO-AN-CC-DN Poultry 1
KJ425512 CO-AN-CG-DN Poultry 206
KC478642 CO-AN-CC-DN Poultry 1
KJ584359 CO-AN-CG-DN Porcine 128
KJ872796 CO-AN-CC-DN Poultry 0
KC478652 CO-AN-CC-DN Poultry 0
KJ940512 CO-AN-CC-DN Poultry 0
KJ425487 CO-AN-CG-DN Poultry 205
KJ425505 CO-AN-CG-DN Poultry 207
KJ435285 CO-AN-CG-DN Poultry 207
KJ425492 CO-AN-CG-DN Poultry 208
KJ940518 CO-AN-CC-DN Poultry 0
KJ940507 CO-AN-CC-DN Poultry 0
KM279003 CO-AN-CC-DN Poultry 0
KJ872787 CO-AN-CC-DN Poultry 0
KJ940506 CO-AN-CC-DN Poultry 0
KJ469748 CO-AN-CC-DN Poultry 0
KF996280 CO-AN-CC-DN Poultry 1
KM365465 CO-AN-CC-DN Poultry 11
KF411041 CO-AN-CG-DN Poultry 195
KJ435284 CO-AN-CG-DN Poultry 206
KJ940528 CO-AN-CC-DN Poultry 0
KJ569769 CO-AN-CG-DN Porcine 129
KF574761 CO-AN-CG-DN Poultry 194
KM279008 CO-AN-CC-DN Poultry 0
KJ940536 CO-AN-CC-DN Poultry 0
KF625030 CO-AN-CC-DN Poultry 0
KJ425494 CO-AN-CG-DN Poultry 206
KJ940513 CO-AN-CC-DN Poultry 0
KJ584355 CO-AN-CG-DN Porcine 129
KM279005 CO-AN-CC-DN Poultry 0
KJ940505 CO-AN-CC-DN Poultry 1
KJ940541 CO-AN-CC-DN Poultry 0
KJ940520 CO-AN-CC-DN Poultry 0
KJ469738 CO-AN-CC-DN Poultry 2
KM213963 CO-AN-CG-DN Poultry 186
KJ940542 CO-AN-CC-DN Poultry 0
KC478644 CO-AN-CC-DN Poultry 1
KM279002 CO-AN-CC-DN Poultry 0
KM279000 CO-AN-CC-DN Poultry 0
KJ872786 CO-AN-CC-DN Poultry 0
KJ469745 CO-AN-CC-DN Poultry 2
KJ425511 CO-AN-CG-DN Poultry 208
KM586818 CO-AN-CG-DN Poultry 190
KJ584357 CO-AN-CG-DN Porcine 129
KF663560 CO-AN-CG-DN Poultry 219
KJ872792 CO-AN-CC-DN Poultry 0
KJ940509 CO-AN-CC-DN Poultry 0
KF188436 CO-AN-CC-DN Poultry 0
KF668605 CO-AN-CG-DN Poultry 182
KF188435 CO-AN-CC-DN Poultry 0
KJ940502 CO-AN-CC-DN Poultry 0
KJ128295 CO-AN-CG-DN Poultry 191
KJ425500 CO-AN-CG-DN Poultry 206
KF663559 CO-AN-CG-DN Poultry 173
KJ940500 CO-AN-CC-DN Poultry 0
KJ567050 CO-AN-CG-DN Porcine 126
KJ584358 CO-AN-CG-DN Porcine 127
KJ872788 CO-AN-CC-DN Poultry 0
KJ872795 CO-AN-CC-DN Poultry 0
KC119407 CO-AN-CG-DN Poultry 183
KJ940510 CO-AN-CC-DN Poultry 0
KJ940547 CO-AN-CC-DN Poultry 0
KJ940535 CO-AN-CC-DN Poultry 0
KJ940546 CO-AN-CC-DN Poultry 0
KF975407 CO-AN-CC-DN Poultry 0
KJ940534 CO-AN-CC-DN Poultry 0
KF996276 CO-AN-CC-DN Poultry 0
KJ425485 CO-AN-CG-DN Poultry 209
KJ435286 CO-AN-CG-DN Poultry 187
KJ940524 CO-AN-CC-DN Poultry 0
KJ940504 CO-AN-CC-DN Poultry 0
KJ425498 CO-AN-CG-DN Poultry 207
KC478645 CO-AN-CC-DN Poultry 0
KJ469737 CO-AN-CC-DN Poultry 3
KM279004 CO-AN-CC-DN Poultry 0
KJ940540 CO-AN-CC-DN Poultry 0
KJ940519 CO-AN-CC-DN Poultry 0
KJ425486 CO-AN-CG-DN Poultry 205
KJ940511 CO-AN-CC-DN Poultry 0
KJ425493 CO-AN-CG-DN Poultry 206
KJ425508 CO-AN-CG-DN Poultry 208
KJ425509 CO-AN-CG-DN Poultry 206
KJ940544 CO-AN-CC-DN Poultry 0
KJ940527 CO-AN-CC-DN Poultry 0
KF996283 CO-AN-CC-DN Poultry 0
KJ425496 CO-AN-CG-DN Poultry 199
KC136209 CO-AN-CG-DN Poultry 216
KJ469742 CO-AN-CC-DN Poultry 2
KF853202 CO-AN-CG-DN Poultry 188
KM365466 CO-AN-CC-DN Poultry 11
KM365467 CO-AN-CC-DN Poultry 9
KM278995 CO-AN-CC-DN Poultry 0
KJ940498 CO-AN-CC-DN Poultry 0
KF975404 CO-AN-CC-DN Poultry 0
KJ669722 CO-AN-CC-DN Poultry 13
KJ469744 CO-AN-CC-DN Poultry 2
KJ872790 CO-AN-CC-DN Poultry 0
KJ940526 CO-AN-CC-DN Poultry 0
KJ940525 CO-AN-CC-DN Poultry 0
KJ425488 CO-AN-CG-DN Poultry 207
KM365468 CO-AN-CC-DN Poultry 8
KM279007 CO-AN-CC-DN Poultry 0
KJ940521 CO-AN-CC-DN Poultry 0
KJ469739 CO-AN-CC-DN Poultry 2
KJ940522 CO-AN-CC-DN Poultry 0
KJ940501 CO-AN-CC-DN Poultry 1
KJ425503 CO-AN-CG-DN Poultry 206
KJ940523 CO-AN-CC-DN Poultry 0
KC013541 CO-AN-CG-DN Poultry 183
KJ425510 CO-AN-CG-DN Poultry 207
KJ940533 CO-AN-CC-DN Poultry 0
KF975406 CO-AN-CC-DN Poultry 0
KJ940530 CO-AN-CC-DN Poultry 0
KJ872791 CO-AN-CC-DN Poultry 0
KJ940529 CO-AN-CC-DN Poultry 0
KJ940539 CO-AN-CC-DN Poultry 0
KJ462462 CO-AN-CG-DN Porcine 129
KM278999 CO-AN-CC-DN Poultry 0
KJ425491 CO-AN-CG-DN Poultry 206
KM820765 CO-AN-CG-DN Porcine 131
KJ872785 CO-AN-CC-DN Poultry 0
KF996284 CO-AN-CC-DN Poultry 1
KF996277 CO-AN-CC-DN Poultry 0
KJ425504 CO-AN-CG-DN Poultry 189
KM365469 CO-AN-CC-DN Poultry 11
KF663561 CO-AN-CG-DN Poultry 190
KF411040 CO-AN-CG-DN Poultry 189
KJ940531 CO-AN-CC-DN Poultry 0
KF834569 CO-AN-CC-DN Poultry 0
KF996279 CO-AN-CC-DN Poultry 1
KJ469743 CO-AN-CC-DN Poultry 2
KJ940516 CO-AN-CC-DN Poultry 0
KJ940499 CO-AN-CC-DN Poultry 1
KJ469741 CO-AN-CC-DN Poultry 2
KJ620016 CO-AN-CG-DN Porcine 128
KM278997 CO-AN-CC-DN Poultry 0
KJ940514 CO-AN-CC-DN Poultry 0
KJ940515 CO-AN-CC-DN Poultry 0
KM278996 CO-AN-CC-DN Poultry 0
KJ135013 CO-AN-CG-DN Poultry 193
KF996275 CO-AN-CC-DN Poultry 0
KM012168 CO-AN-CG-DN Porcine 128
KC256943 CO-AN-CC-DN Poultry 0
KJ584356 CO-AN-CG-DN Porcine 128
KJ940532 CO-AN-CC-DN Poultry 0
KC478643 CO-AN-CC-DN Poultry 0
KJ872784 CO-AN-CC-DN Poultry 0
KC478651 CO-AN-CC-DN Poultry 0
KJ425499 CO-AN-CG-DN Poultry 209
KY078896 CO-AN-CC-DN Porcine 0
KY078910 CO-AN-CC-DN Porcine 0
KT021234 CO-AN-CG-DN Porcine 123
KU900738 CO-AN-CG-DN Poultry 196
KT313668 CO-AN-CC-DN Porcine 0
KR265848 CO-AN-CG-DN Porcine 127
KY398014 CO-AN-CC-RN Porcine 0
KX348115 CO-AN-CG-DN Poultry 198
KX252790 CO-AN-CG-DN Poultry 194
KT313685 CO-AN-CC-DN Porcine 0
KU900744 CO-AN-CG-DN Poultry 199
KY364365 CO-AN-CG-DN Porcine 128
KP995357 CO-AN-CC-DN Porcine 1
KX236000 CO-AN-CG-DN Poultry 194
KX236011 CO-AN-CG-DN Poultry 197
KP118880 CO-AN-CG-DN Poultry 199
KT021235 CO-AN-CC-RN Porcine 1
KY926511 CO-AN-CC-DN Porcine 2
KX252774 CO-AN-CG-DN Poultry 204
KX259252 CO-AN-CG-DN Poultry 193
KX236015 CO-AN-CG-DN Poultry 196
KY419107 CO-AN-CG-DN Porcine 252
KP662631 CO-AN-CG-DN Poultry 179
KX252772 CO-AN-CG-DN Poultry 205
KX219794 CO-AN-CG-DN Poultry 181
KX364300 CO-AN-CG-DN Poultry 184
KX252791 CO-AN-CG-DN Poultry 204
KX364299 CO-AN-CG-DN Poultry 183
KR265857 CO-AN-CG-DN Porcine 128
KR265088 CO-AN-CC-DN Poultry 16
KY354364 CO-AN-CG-DN Porcine 128
KU870482 CO-AN-CC-DN Porcine 0
KP118887 CO-AN-CG-DN Poultry 202
KX247130 CO-AN-CG-DN Poultry 203
KY398013 CO-AN-CC-RN Porcine 0
KX834351 CO-AN-CG-DN Porcine 130
KX252773 CO-AN-CG-DN Poultry 197
KX236013 CO-AN-CG-DN Poultry 197
KX236008 CO-AN-CG-DN Poultry 195
KX275394 CO-AN-CG-DN Poultry 198
KX302862 CO-AN-CG-DN Poultry 181
KU900741 CO-AN-CG-DN Poultry 196
KT021242 CO-AN-CC-RN Porcine 1
KR265091 CO-AN-CC-DN Poultry 13
KX375807 CO-AN-CG-DN Poultry 209
KX364292 CO-AN-CG-DN Poultry 206
KY419108 CO-AN-CG-DN Porcine 0
KT313681 CO-AN-CC-DN Porcine 0
KU870485 CO-AN-CC-DN Porcine 0
KR265858 CO-AN-CG-DN Porcine 127
KU900743 CO-AN-CG-DN Poultry 206
KX275391 CO-AN-CG-DN Poultry 194
KX236014 CO-AN-CG-DN Poultry 201
KU356856 CO-AN-CG-DN Poultry 199
KU253621 CO-AN-CC-DN Poultry 12
KT313670 CO-AN-CC-DN Porcine 0
KU870481 CO-AN-CC-DN Porcine 0
KX077987 CO-AN-CG-DN Poultry 193
KR265856 CO-AN-CG-DN Porcine 128
KY078907 CO-AN-CC-DN Porcine 0
KT371501 CO-AN-CC-RN Porcine 1
KX252779 CO-AN-CG-DN Poultry 193
KX247129 CO-AN-CG-DN Poultry 202
KX364298 CO-AN-CG-DN Poultry 211
KT021240 CO-AN-CC-RN Porcine 1
KP757892 CO-AN-CG-DN Porcine 125
KT945050 CO-AN-CC-DN Porcine 1
KX259256 CO-AN-CG-DN Poultry 208
KR265860 CO-AN-CG-DN Porcine 129
KX258195 CO-AN-CG-DN Poultry 206
KP995364 CO-AN-CC-DN Porcine 0
KU253617 CO-AN-CC-DN Poultry 12
KY992865 CO-AN-CC-DN Poultry 2
KT021238 CO-AN-CC-RN Porcine 1
KX710201 CO-AN-CC-DN Porcine 1
KT313678 CO-AN-CC-DN Porcine 0
KX640829 CO-AN-CG-DN Poultry 188
KT371507 CO-AN-CC-RN Porcine 0
KY078913 CO-AN-CC-DN Porcine 1
KX252778 CO-AN-CG-DN Poultry 194
KR902510 CO-AN-CG-DN Poultry 180
KY419104 CO-AN-CG-DN Porcine 262
KX302861 CO-AN-CG-DN Poultry 191
KY419103 CO-AN-CG-DN Porcine 249
KP995368 CO-AN-CC-DN Porcine 0
KP757890 CO-AN-CG-DN Porcine 122
KT266822 CO-AN-CG-DN Porcine 122
KU517165 CO-AN-CC-DN Porcine 0
KT021239 CO-AN-CC-RN Porcine 1
KX302875 CO-AN-CG-DN Poultry 216
KY293678 CO-AN-CG-DN Porcine 118
KP995360 CO-AN-CC-DN Porcine 1
KR231009 CO-AN-CG-DN Poultry 189
KX252781 CO-AN-CG-DN Poultry 200
KY496312 CO-AN-CC-DN Porcine 1
KT313671 CO-AN-CC-DN Porcine 0
KT886454 CO-AN-CG-DN Poultry 202
KY078893 CO-AN-CC-DN Porcine 0
KU361187 CO-AN-CG-DN Poultry 195
KX236007 CO-AN-CG-DN Poultry 182
KX302873 CO-AN-CG-DN Poultry 204
KR265092 CO-AN-CC-DN Poultry 13
KX302874 CO-AN-CG-DN Poultry 202
KY078901 CO-AN-CC-DN Porcine 0
KX118627 CO-AN-CG-DN Porcine 125
KU981062 CO-AN-CG-DN Porcine 129
KP118894 CO-AN-CG-DN Poultry 199
KU981059 CO-AN-CG-DN Porcine 129
KR265085 CO-AN-CC-DN Poultry 14
KY078903 CO-AN-CC-DN Porcine 0
KU253622 CO-AN-CC-DN Poultry 12
KX710202 CO-AN-CC-DN Porcine 1
KY586147 CO-AN-CC-DN Porcine 0
KT188788 CO-AN-CC-DN Poultry 0
KX219796 CO-AN-CG-DN Poultry 188
KX259249 CO-AN-CG-DN Poultry 204
KU204695 CO-AN-CC-DN Porcine 1
KP036504 CO-AN-CG-DN Poultry 197
KX259250 CO-AN-CG-DN Poultry 181
KU870483 CO-AN-CC-DN Porcine 0
KY992863 CO-AN-CC-DN Poultry 2
KX185058 CO-AN-CG-DN Poultry 196
KP118890 CO-AN-CG-DN Poultry 195
KP036502 CO-AN-CG-DN Poultry 192
KY078895 CO-AN-CC-DN Porcine 0
KU981061 CO-AN-CG-DN Porcine 129
KT313683 CO-AN-CC-DN Porcine 0
KU900739 CO-AN-CG-DN Poultry 188
KX275390 CO-AN-CG-DN Poultry 194
KP868572 CO-AN-CG-DN Poultry 191
KX302866 CO-AN-CG-DN Poultry 194
KU900740 CO-AN-CG-DN Poultry 191
KY078906 CO-AN-CC-DN Porcine 2
KT371502 CO-AN-CC-RN Porcine 1
KY407558 CO-AN-CG-DN Poultry 191
KX247128 CO-AN-CG-DN Poultry 203
KY065120 CO-AN-CG-DN Porcine 116
KY363867 CO-AN-CG-DN Porcine 121
KP118889 CO-AN-CG-DN Poultry 194
KY407556 CO-AN-CG-DN Poultry 193
KU051649 CO-AN-CG-DN Porcine 127
KX236002 CO-AN-CG-DN Poultry 180
KP995363 CO-AN-CC-DN Porcine 0
KT313664 CO-AN-CC-DN Porcine 0
KX022605 CO-AN-CG-DN Porcine 126
KU870486 CO-AN-CC-DN Porcine 0
KY419111 CO-AN-CG-DN Porcine 252
KX219792 CO-AN-CG-DN Poultry 201
KX375806 CO-AN-CG-DN Poultry 204
KT371500 CO-AN-CC-RN Porcine 1
KP118883 CO-AN-CG-DN Poultry 200
KR265849 CO-AN-CG-DN Porcine 127
KU253620 CO-AN-CC-DN Poultry 12
KU204694 CO-AN-CC-DN Porcine 1
KY407557 CO-AN-CG-DN Poultry 189
KU870484 CO-AN-CC-DN Porcine 0
KX252775 CO-AN-CG-DN Poultry 200
KX252782 CO-AN-CG-DN Poultry 191
KP118888 CO-AN-CG-DN Poultry 201
KY293677 CO-AN-CG-DN Porcine 118
KT188789 CO-AN-CC-DN Poultry 0
KP995356 CO-AN-CC-DN Porcine 1
KX400753 CO-AN-CG-DN Poultry 195
KT313675 CO-AN-CC-DN Porcine 0
KX434788 CO-AN-CG-DN Poultry 200
KP981395 CO-AN-CG-DN Porcine 128
KY419109 CO-AN-CG-DN Porcine 252
KY926512 CO-AN-CG-DN Porcine 131
KP995365 CO-AN-CC-DN Porcine 0
KY078900 CO-AN-CC-DN Porcine 0
KX302870 CO-AN-CG-DN Poultry 196
KU204696 CO-AN-CC-DN Porcine 1
KR265864 CO-AN-CG-DN Porcine 127
KX219800 CO-AN-CG-DN Poultry 198
KX236003 CO-AN-CG-DN Poultry 187
KX302868 CO-AN-CG-DN Poultry 191
KP995369 CO-AN-CC-DN Porcine 0
KR060084 CO-AN-CC-DN Porcine 0
KT313677 CO-AN-CC-DN Porcine 0
KX236006 CO-AN-CG-DN Poultry 191
KR265855 CO-AN-CG-DN Porcine 126
KX219798 CO-AN-CG-DN Poultry 201
KX710203 CO-AN-CC-DN Porcine 0
KP118881 CO-AN-CG-DN Poultry 197
KX302872 CO-AN-CG-DN Poultry 184
KT945051 CO-AN-CC-DN Porcine 0
KX364293 CO-AN-CG-DN Poultry 190
KX434790 CO-AN-CG-DN Poultry 192
KY799582 CO-AN-CG-DN Poultry 212
KX364297 CO-AN-CG-DN Poultry 189
KR265865 CO-AN-CG-DN Porcine 126
KX302867 CO-AN-CG-DN Poultry 203
KX372249 CO-AN-CG-DN Poultry 198
KR265087 CO-AN-CC-DN Poultry 16
KY363868 CO-AN-CG-DN Porcine 132
KT313669 CO-AN-CC-DN Porcine 0
KP118892 CO-AN-CG-DN Poultry 200
KY436218 CO-AN-CC-DN Porcine 1
KX247127 CO-AN-CG-DN Poultry 205
KU317090 CO-AN-CG-DN Poultry 197
KY078911 CO-AN-CC-DN Porcine 0
KR265859 CO-AN-CG-DN Porcine 127
KP118886 CO-AN-CG-DN Poultry 184
KT313665 CO-AN-CC-DN Porcine 0
KP118885 CO-AN-CG-DN Poultry 195
KU984334 CO-AN-CG-DN Porcine 125
KP868573 CO-AN-CG-DN Poultry 194
KT736032 CO-AN-CG-DN Poultry 201
KU870488 CO-AN-CC-DN Porcine 0
KP995367 CO-AN-CC-DN Porcine 0
KP036505 CO-AN-CG-DN Poultry 191
KY513724 CO-AN-CG-DN Porcine 125
KY398011 CO-AN-CC-RN Porcine 0
KT371506 CO-AN-CC-RN Porcine 0
KP118884 CO-AN-CG-DN Poultry 201
KX375808 CO-AN-CG-DN Poultry 184
KY354363 CO-AN-CG-DN Porcine 128
KX252789 CO-AN-CG-DN Poultry 193
KY805846 CO-AN-CG-DN Poultry 224
KR608272 CO-AN-CG-DN Poultry 199
KX259251 CO-AN-CG-DN Poultry 186
KX236001 CO-AN-CG-DN Poultry 208
KP790145 CO-AN-CG-DN Poultry 185
KX252777 CO-AN-CG-DN Poultry 208
KP790146 CO-AN-CG-DN Poultry 189
KX434789 CO-AN-CG-DN Poultry 191
KX219797 CO-AN-CG-DN Poultry 206
KX236016 CO-AN-CG-DN Poultry 196
KP995362 CO-AN-CC-DN Porcine 1
KY078892 CO-AN-CC-DN Porcine 0
KU204699 CO-AN-CC-DN Porcine 0
KY421673 CO-AN-CG-DN Poultry 192
KX364290 CO-AN-CG-DN Poultry 198
KT313667 CO-AN-CC-DN Porcine 0
KX272465 CO-AN-CG-DN Poultry 194
KY933089 CO-AN-CG-DN Poultry 200
KU204701 CO-AN-CC-DN Porcine 0
KX425847 CO-AN-CG-DN Poultry 197
KR265853 CO-AN-CG-DN Porcine 124
KT946798 CO-AN-CG-DN Poultry 190
KU253619 CO-AN-CC-DN Poultry 12
KY419113 CO-AN-CG-DN Porcine 254
KY078914 CO-AN-CC-DN Porcine 0
KT313680 CO-AN-CC-DN Porcine 0
KX710204 CO-AN-CC-DN Porcine 0
KT313679 CO-AN-CC-DN Porcine 0
KX364295 CO-AN-CG-DN Poultry 206
KX998969 CO-AN-CG-DN Porcine 123
KR265852 CO-AN-CG-DN Porcine 128
KP085588 CO-AN-CC-DN Poultry 0
KX236012 CO-AN-CG-DN Poultry 199
KR265850 CO-AN-CG-DN Porcine 128
KY776701 CO-AN-CG-DN Poultry 190
KT313674 CO-AN-CC-DN Porcine 0
KX443143 CO-AN-CG-DN Porcine 126
KY078912 CO-AN-CC-DN Porcine 1
KX534091 CO-AN-CC-DN Porcine 0
KY078891 CO-AN-CC-DN Porcine 0
KX022602 CO-AN-CG-DN Porcine 125
KY805845 CO-AN-CG-DN Poultry 207
KR265851 CO-AN-CG-DN Porcine 127
KY398010 CO-AN-CC-RN Porcine 0
KR265089 CO-AN-CC-DN Poultry 11
KP790144 CO-AN-CG-DN Poultry 204
KR150443 CO-AN-CG-DN Porcine 128
KX302865 CO-AN-CG-DN Poultry 190
KT736031 CO-AN-CG-DN Poultry 204
KU870489 CO-AN-CC-DN Porcine 0
KU981060 CO-AN-CG-DN Porcine 129
KU665558 CO-AN-CG-DN Porcine 117
KX259253 CO-AN-CG-DN Poultry 200
KY586149 CO-AN-CC-DN Porcine 0
KX252787 CO-AN-CG-DN Poultry 191
KX259254 CO-AN-CG-DN Poultry 193
KU051641 CO-AN-CG-DN Porcine 128
KT381613 CO-AN-CG-DN Porcine 129
KX252785 CO-AN-CG-DN Poultry 203
KY419112 CO-AN-CG-DN Porcine 262
KY419106 CO-AN-CG-DN Porcine 252
KP118891 CO-AN-CG-DN Poultry 199
KT021236 CO-AN-CC-RN Porcine 1
KP995361 CO-AN-CC-DN Porcine 1
KU204700 CO-AN-CC-DN Porcine 0
KR265086 CO-AN-CC-DN Poultry 14
KY078897 CO-AN-CC-DN Porcine 0
KR265084 CO-AN-CC-DN Poultry 11
KX348117 CO-AN-CG-DN Poultry 197
KY586148 CO-AN-CC-DN Porcine 0
KR270796 CO-AN-CG-DN Porcine 199
KT371505 CO-AN-CC-RN Porcine 0
KX275393 CO-AN-CG-DN Poultry 201
KT203557 CO-AN-CG-DN Poultry 204
KX236005 CO-AN-CG-DN Poultry 197
KX252780 CO-AN-CG-DN Poultry 194
KR265861 CO-AN-CG-DN Porcine 127
KU900742 CO-AN-CG-DN Poultry 195
KX236004 CO-AN-CG-DN Poultry 187
KT313673 CO-AN-CC-DN Porcine 0
KT313684 CO-AN-CC-DN Porcine 0
KT313682 CO-AN-CC-DN Porcine 0
KX302863 CO-AN-CG-DN Poultry 189
KX302864 CO-AN-CG-DN Poultry 187
KU253618 CO-AN-CC-DN Poultry 10
KP995358 CO-AN-CC-DN Porcine 1
KY078908 CO-AN-CC-DN Porcine 1
KX022603 CO-AN-CG-DN Porcine 128
KP118882 CO-AN-CG-DN Poultry 199
KU253623 CO-AN-CC-DN Poultry 13
KY419105 CO-AN-CG-DN Porcine 261
KU253624 CO-AN-CC-DN Poultry 12
KT021241 CO-AN-CC-RN Porcine 1
KX364296 CO-AN-CG-DN Poultry 193
KX372250 CO-AN-CG-DN Poultry 194
KR060085 CO-AN-CC-DN Porcine 0
KX302860 CO-AN-CG-DN Poultry 208
KY078909 CO-AN-CC-DN Porcine 0
KX236010 CO-AN-CG-DN Poultry 183
KX252783 CO-AN-CG-DN Poultry 203
KT313666 CO-AN-CC-DN Porcine 0
KT371504 CO-AN-CC-RN Porcine 0
KT313676 CO-AN-CC-DN Porcine 0
KY078905 CO-AN-CC-DN Porcine 1
KT021237 CO-AN-CC-RN Porcine 1
KY513725 CO-AN-CG-DN Porcine 125
KX348114 CO-AN-CG-DN Poultry 213
KT313672 CO-AN-CC-DN Porcine 0
KT371503 CO-AN-CC-RN Porcine 1
KX364291 CO-AN-CG-DN Poultry 208
KX275392 CO-AN-CG-DN Poultry 207
KR131621 CO-AN-CG-DN Porcine 120
KR265863 CO-AN-CG-DN Porcine 125
KP036503 CO-AN-CG-DN Poultry 200
KP780179 CO-AN-CG-DN Poultry 192
KX219795 CO-AN-CG-DN Poultry 197
KU361188 CO-AN-CG-DN Poultry 175
KU870490 CO-AN-CC-DN Porcine 0
KX219793 CO-AN-CG-DN Poultry 199
KR265854 CO-AN-CG-DN Porcine 127
KU870479 CO-AN-CC-DN Porcine 0
KR060082 CO-AN-CC-DN Porcine 1
KY078904 CO-AN-CC-DN Porcine 0
KU870487 CO-AN-CC-DN Porcine 0
KP995359 CO-AN-CC-DN Porcine 1
KY776700 CO-AN-CG-DN Poultry 191
KX534090 CO-AN-CC-DN Porcine 1
KY620116 CO-AN-CG-DN Poultry 182
KT313663 CO-AN-CC-DN Porcine 0
KU204698 CO-AN-CC-DN Porcine 0
KY078915 CO-AN-CC-DN Porcine 1
KY406735 CO-AN-CG-DN Porcine 207
KX259248 CO-AN-CG-DN Poultry 212
KY398012 CO-AN-CC-RN Porcine 0
KT313686 CO-AN-CC-DN Porcine 0
KP790143 CO-AN-CG-DN Poultry 192
KX834352 CO-AN-CG-DN Porcine 130
KU253616 CO-AN-CC-DN Poultry 12
KY992864 CO-AN-CC-DN Poultry 2
KY047602 CO-AN-CG-DN Poultry 202
KR265847 CO-AN-CG-DN Porcine 130
KX022604 CO-AN-CG-DN Porcine 129
KX219799 CO-AN-CG-DN Poultry 197
KX364294 CO-AN-CG-DN Poultry 203
KX252788 CO-AN-CG-DN Poultry 202
KX185057 CO-AN-CG-DN Poultry 196
KX375805 CO-AN-CG-DN Poultry 198
KX389094 CO-AN-CG-DN Poultry 182
KX302869 CO-AN-CG-DN Poultry 200
KY078916 CO-AN-CC-DN Porcine 1
KP757891 CO-AN-CG-DN Porcine 124
KP343691 CO-AN-CG-DN Poultry 194
KX219801 CO-AN-CG-DN Poultry 206
KX185056 CO-AN-CG-DN Poultry 196
KR265090 CO-AN-CC-DN Poultry 14
KX185059 CO-AN-CG-DN Poultry 194
KX348116 CO-AN-CG-DN Poultry 203
KY994645 CO-AN-CG-DN Porcine 264
KP995366 CO-AN-CC-DN Porcine 0
KR060083 CO-AN-CC-DN Porcine 1
KP118893 CO-AN-CG-DN Poultry 200
KX252776 CO-AN-CG-DN Poultry 194
KX252786 CO-AN-CG-DN Poultry 205
KY421672 CO-AN-CG-DN Poultry 196
KT336560 CO-AN-CG-DN Porcine 118
KX259255 CO-AN-CG-DN Poultry 205
KY078898 CO-AN-CC-DN Porcine 0
KX219791 CO-AN-CG-DN Poultry 195
KT852992 CO-AN-CG-DN Poultry 203
KU204697 CO-AN-CC-DN Porcine 1
KX236009 CO-AN-CG-DN Poultry 183
KY078902 CO-AN-CC-DN Porcine 0
KX252784 CO-AN-CG-DN Poultry 192
KX266757 CO-AN-CG-DN Poultry 178
KY078894 CO-AN-CC-DN Porcine 0
KY419110 CO-AN-CG-DN Porcine 262
KX259257 CO-AN-CG-DN Poultry 192
KY078899 CO-AN-CC-DN Porcine 0
KU870480 CO-AN-CC-DN Porcine 0
KX302871 CO-AN-CG-DN Poultry 201
KR265862 CO-AN-CG-DN Porcine 124
MK355396 CO-AN-CG-DN Porcine 122
MK478380 CO-AN-CC-DN Porcine 1
MN894508 CO-AN-CC-DN Poultry 0
MN173812 CO-AN-CC-DN Porcine 3
MK887136 CO-AN-CC-DN Poultry 0
MH025762 CO-AN-CG-DN Porcine 120
MK309398 CO-AN-CG-DN Poultry 182
MF457616 CO-AN-CC-DN Porcine 0
MH020185 CO-AN-CG-DN Poultry 196
MK887100 CO-AN-CC-DN Poultry 0
MF457605 CO-AN-CC-DN Porcine 0
MN173805 CO-AN-CC-DN Porcine 1
MF457621 CO-AN-CC-DN Porcine 0
MH779857 CO-AN-CG-DN Poultry 200
MF457607 CO-AN-CC-DN Porcine 0
MN512436 CO-AN-CG-DN Poultry 206
MK887069 CO-AN-CC-DN Poultry 0
MK510443 CO-AN-CC-DN Poultry 2
MK032181 CO-AN-CG-DN Porcine 203
MN173807 CO-AN-CC-DN Porcine 2
M94097 CO-AN-CC-DN Porcine 3
MG738154 CO-AN-CG-DN Poultry 194
MF346689 CO-AN-CC-DN Poultry 1
MK887134 CO-AN-CC-DN Poultry 0
MG832584 CO-AN-CG-DN Porcine 122
MK887098 CO-AN-CC-DN Poultry 0
MG448607 CO-AN-CG-DN Poultry 196
MN173803 CO-AN-CC-DN Porcine 1
MK574042 CO-AN-CG-DN Porcine 188
MK937830 CO-AN-CG-DN Porcine 186
MF421320 CO-AN-CG-DN Poultry 203
MF457630 CO-AN-CC-DN Porcine 0
MG544177 CO-AN-CC-DN Poultry 2
MK510427 CO-AN-CC-DN Poultry 2
MK510445 CO-AN-CC-DN Poultry 2
MN512437 CO-AN-CG-DN Poultry 208
MK581205 CO-AN-CG-DN Poultry 197
MF037204 CO-AN-CC-DN Porcine 1
MF457626 CO-AN-CC-DN Porcine 0
MK217375 CO-AN-CG-DN Porcine 178
MN173810 CO-AN-CC-DN Porcine 2
MH779856 CO-AN-CG-DN Poultry 200
MK887110 CO-AN-CC-DN Poultry 1
MK510437 CO-AN-CC-DN Poultry 2
MK887078 CO-AN-CC-DN Poultry 0
MK887068 CO-AN-CC-DN Poultry 0
MK211169 CO-AN-CG-DN Porcine 125
MH151329 CO-AN-CC-DN Poultry 0
MN173809 CO-AN-CC-DN Porcine 2
MN173788 CO-AN-CC-DN Porcine 0
MN894507 CO-AN-CC-DN Poultry 2
MN064712 CO-AN-CC-DN Porcine 1
MK887124 CO-AN-CC-DN Poultry 0
M21950 CO-AN-CC-DN Porcine 2
MH708123 CO-AN-CG-DN Porcine 121
MN517816 CO-AN-CG-DN Poultry 195
MN368608 CO-AN-CC-DN Porcine 1
MF457613 CO-AN-CC-DN Porcine 0
MF461408 CO-AN-CC-RN Porcine 1
MF642323 CO-AN-CG-DN Porcine 125
MK937828 CO-AN-CG-DN Porcine 189
MH539766 CO-AN-CG-DN Porcine 172
MN368607 CO-AN-CC-DN Porcine 1
MK673766 CO-AN-CC-DN Porcine 0
MK510428 CO-AN-CC-DN Poultry 2
MF167434 CO-AN-CG-DN Porcine 173
MK040447 CO-AN-CC-DN Porcine 1
MG233398 CO-AN-CG-DN Poultry 198
MK005882 CO-AN-CG-DN Porcine 120
MK887108 CO-AN-CC-DN Poultry 1
MK887072 CO-AN-CC-DN Poultry 0
MK887092 CO-AN-CC-DN Poultry 1
MK887114 CO-AN-CC-DN Poultry 0
MN531556 CO-AN-CG-DN Poultry 190
MH697599 CO-AN-CG-DN Porcine 177
MK581204 CO-AN-CG-DN Poultry 210
MN173785 CO-AN-CC-DN Porcine 0
MK581202 CO-AN-CG-DN Poultry 227
MF083115 CO-AN-CG-DN Porcine 264
MK887125 CO-AN-CC-DN Poultry 0
MK887121 CO-AN-CC-DN Poultry 0
MN512435 CO-AN-CG-DN Poultry 206
MF457601 CO-AN-CC-DN Porcine 0
MK887130 CO-AN-CC-DN Poultry 1
MN894509 CO-AN-CC-DN Poultry 0
MK887131 CO-AN-CC-DN Poultry 0
MK993519 CO-AN-CG-DN Porcine 124
MK887095 CO-AN-CC-DN Poultry 0
MK887133 CO-AN-CC-DN Poultry 0
MK887126 CO-AN-CC-DN Poultry 0
MN894511 CO-AN-CC-DN Poultry 0
MK581200 CO-AN-CG-DN Poultry 193
MK478381 CO-AN-CC-DN Porcine 1
MK510434 CO-AN-CC-DN Poultry 2
MK581208 CO-AN-CG-DN Poultry 219
MH025764 CO-AN-CG-DN Porcine 122
MK887107 CO-AN-CC-DN Poultry 1
MH539772 CO-AN-CG-DN Poultry 187
MK887076 CO-AN-CC-DN Poultry 0
MF461407 CO-AN-CC-RN Porcine 1
MF461409 CO-AN-CC-RN Porcine 1
MK887097 CO-AN-CC-DN Poultry 1
MF457620 CO-AN-CC-DN Porcine 0
MF457602 CO-AN-CC-DN Porcine 0
MK887120 CO-AN-CC-DN Poultry 0
MF457599 CO-AN-CC-DN Porcine 0
MK887111 CO-AN-CC-DN Poultry 0
MF461412 CO-AN-CC-RN Porcine 1
MF457597 CO-AN-CC-DN Porcine 0
MN566147 CO-AN-CG-DN Poultry 191
MK510429 CO-AN-CC-DN Poultry 2
MN025260 CO-AN-CG-DN Porcine 120
MF461411 CO-AN-CC-RN Porcine 1
MF457596 CO-AN-CC-DN Porcine 0
MN894514 CO-AN-CC-DN Poultry 0
MK887073 CO-AN-CC-DN Poultry 0
MN173806 CO-AN-CC-DN Porcine 1
MK887135 CO-AN-CC-DN Poultry 0
MK887113 CO-AN-CC-DN Poultry 0
MK878536 CO-AN-CG-DN Poultry 191
MF041982 CO-AN-CG-DN Porcine 118
MK887129 CO-AN-CC-DN Poultry 0
MF461406 CO-AN-CC-RN Porcine 1
MH708125 CO-AN-CG-DN Porcine 121
MN173786 CO-AN-CC-DN Porcine 0
MN894510 CO-AN-CC-DN Poultry 0
MK887118 CO-AN-CC-DN Poultry 0
MK510447 CO-AN-CC-DN Poultry 2
MK887091 CO-AN-CC-DN Poultry 0
MK510441 CO-AN-CC-DN Poultry 2
MK510435 CO-AN-CC-DN Poultry 3
MN096598 CO-AN-CG-DN Poultry 190
MK937831 CO-AN-CG-DN Porcine 206
MH878976 CO-AN-CG-DN Poultry 206
MN894513 CO-AN-CC-DN Poultry 1
MK887104 CO-AN-CC-DN Poultry 1
MK887079 CO-AN-CC-DN Poultry 0
MG544178 CO-AN-CC-DN Poultry 2
MG913343 CO-AN-CG-DN Poultry 205
MH708124 CO-AN-CG-DN Porcine 121
M94101 CO-AN-CC-DN Porcine 2
MN197549 CO-AN-CG-DN Poultry 177
MN249445 CO-AN-CG-DN Porcine 124
MG837133 CO-AN-CG-DN Porcine 8
MN173792 CO-AN-CC-DN Porcine 0
MF457606 CO-AN-CC-DN Porcine 0
M94099 CO-AN-CC-DN Porcine 2
MF882923 CO-AN-CG-DN Poultry 183
MH779860 CO-AN-CG-DN Poultry 200
MH539771 CO-AN-CG-DN Poultry 186
MK937833 CO-AN-CG-DN Porcine 208
MK887074 CO-AN-CC-DN Poultry 0
MK217374 CO-AN-CG-DN Porcine 182
MN894512 CO-AN-CC-DN Poultry 0
MN509587 CO-AN-CG-DN Poultry 197
MK840961 CO-AN-CC-DN Poultry 3
MN173787 CO-AN-CC-DN Porcine 0
MG897688 CO-AN-CC-RN Porcine 0
MK887085 CO-AN-CC-DN Poultry 0
MK040448 CO-AN-CC-DN Porcine 1
MF457633 CO-AN-CC-DN Porcine 0
MF642325 CO-AN-CG-DN Porcine 126
MG763935 CO-AN-CG-DN Poultry 205
MF431743 CO-AN-CG-DN Porcine 125
MH025763 CO-AN-CG-DN Porcine 122
MK887094 CO-AN-CC-DN Poultry 0
MF176212 CO-AN-CC-DN Poultry 3
MK040445 CO-AN-CC-DN Porcine 1
MF457615 CO-AN-CC-DN Porcine 0
MG837132 CO-AN-CG-DN Porcine 8
MG517474 CO-AN-CG-DN Poultry 188
MK728875 CO-AN-CG-DN Poultry 187
MN173791 CO-AN-CC-DN Porcine 0
MK887099 CO-AN-CC-DN Poultry 1
MK887077 CO-AN-CC-DN Poultry 0
MK329221 CO-AN-CG-DN Poultry 180
MK887081 CO-AN-CC-DN Poultry 0
MF321891 CO-AN-CC-DN Poultry 3
MN517817 CO-AN-CG-DN Poultry 194
MG022115 CO-AN-CC-DN Poultry 0
MF457595 CO-AN-CC-DN Porcine 0
MK040446 CO-AN-CC-DN Porcine 1
MG242062 CO-AN-CG-DN Porcine 122
MK828778 CO-AN-CC-DN Poultry 2
MK032179 CO-AN-CG-DN Porcine 186
MG021194 CO-AN-CG-DN Poultry 188
MH924835 CO-AN-CG-DN Porcine 183
MF457622 CO-AN-CC-DN Porcine 0
MK887075 CO-AN-CC-DN Poultry 0
MN173811 CO-AN-CC-DN Porcine 3
MK510442 CO-AN-CC-DN Poultry 2
MK032177 CO-AN-CG-DN Porcine 189
MK887123 CO-AN-CC-DN Poultry 0
MF457611 CO-AN-CC-DN Porcine 0
MK887093 CO-AN-CC-DN Poultry 1
MF642322 CO-AN-CG-DN Porcine 124
MF508703 CO-AN-CG-DN Poultry 190
MG738155 CO-AN-CG-DN Poultry 185
MH151328 CO-AN-CC-RN Poultry 0
MK040455 CO-AN-CC-DN Porcine 1
MN599049 CO-AN-CG-DN Poultry 188
MF457631 CO-AN-CC-DN Porcine 0
MN262644 CO-AN-CG-DN Poultry 212
MN531555 CO-AN-CG-DN Poultry 194
MK040454 CO-AN-CC-DN Porcine 1
MN531554 CO-AN-CG-DN Poultry 192
MK510444 CO-AN-CC-DN Poultry 2
MK510446 CO-AN-CC-DN Poultry 2
MK040452 CO-AN-CC-DN Porcine 1
MK887096 CO-AN-CC-DN Poultry 0
MK887089 CO-AN-CC-DN Poultry 0
M14878 CO-AN-CC-DN Porcine 1
MF095123 CO-AN-CG-DN Porcine 124
MF457609 CO-AN-CC-DN Porcine 0
MK510448 CO-AN-CC-DN Poultry 2
MK032180 CO-AN-CG-DN Porcine 185
MK510432 CO-AN-CC-DN Poultry 2
MN173783 CO-AN-CC-DN Porcine 0
MF457600 CO-AN-CC-DN Porcine 0
MG837131 CO-AN-CG-DN Porcine 128
MK887102 CO-AN-CC-DN Poultry 1
MK248485 CO-AN-CC-DN Poultry 1
MF457617 CO-AN-CC-DN Porcine 0
MG197727 CO-AN-CG-DN Poultry 186
MG837130 CO-AN-CG-DN Porcine 128
MF421319 CO-AN-CG-DN Poultry 187
MK040449 CO-AN-CC-DN Porcine 2
MK644086 CO-AN-CG-DN Poultry 211
M94103 CO-AN-CC-DN Porcine 3
MH779859 CO-AN-CG-DN Poultry 201
MN509589 CO-AN-CG-DN Poultry 192
MK937829 CO-AN-CG-DN Porcine 206
MK581206 CO-AN-CG-DN Poultry 186
MK887106 CO-AN-CC-DN Poultry 1
MK887128 CO-AN-CC-DN Poultry 0
MF457618 CO-AN-CC-DN Porcine 0
MK887116 CO-AN-CC-DN Poultry 0
MK478382 CO-AN-CC-DN Porcine 1
MK887087 CO-AN-CC-DN Poultry 0
MF457612 CO-AN-CC-DN Porcine 0
MK581203 CO-AN-CG-DN Poultry 192
MK040450 CO-AN-CC-DN Porcine 1
MF457604 CO-AN-CC-DN Porcine 0
MK581201 CO-AN-CG-DN Poultry 198
MF461410 CO-AN-CC-RN Porcine 1
MN512434 CO-AN-CG-DN Poultry 206
MF431742 CO-AN-CG-DN Porcine 119
MK510439 CO-AN-CC-DN Poultry 2
MK217372 CO-AN-CG-DN Porcine 180
MF642324 CO-AN-CG-DN Porcine 125
MF176213 CO-AN-CC-DN Poultry 0
MH159179 CO-AN-CC-DN Poultry 0
MK887080 CO-AN-CC-DN Poultry 0
MF924724 CO-AN-CG-DN Poultry 199
MF457619 CO-AN-CC-DN Porcine 0
MK887105 CO-AN-CC-DN Poultry 1
MK887090 CO-AN-CC-DN Poultry 0
MN173808 CO-AN-CC-DN Porcine 1
MK887083 CO-AN-CC-DN Poultry 0
MG913342 CO-AN-CG-DN Poultry 201
MK572803 CO-AN-CG-DN Porcine 128
MN509588 CO-AN-CG-DN Poultry 190
MK032178 CO-AN-CG-DN Porcine 181
MF457624 CO-AN-CC-DN Porcine 0
MG742313 CO-AN-CG-DN Porcine 176
MH715491 CO-AN-CG-DN Porcine 122
MN894506 CO-AN-CC-DN Poultry 16
MF457603 CO-AN-CC-DN Porcine 0
MF457632 CO-AN-CC-DN Porcine 0
MF457608 CO-AN-CC-DN Porcine 0
MK330605 CO-AN-CG-DN Porcine 120
MF457614 CO-AN-CC-DN Porcine 0
MH779858 CO-AN-CG-DN Poultry 200
MK887122 CO-AN-CC-DN Poultry 0
MK887070 CO-AN-CC-DN Poultry 0
MF457627 CO-AN-CC-DN Porcine 0
MK887071 CO-AN-CC-DN Poultry 0
MK510431 CO-AN-CC-DN Poultry 2
MK887101 CO-AN-CC-DN Poultry 0
MN894505 CO-AN-CC-DN Poultry 40
MF457629 CO-AN-CC-DN Porcine 0
MF948005 CO-AN-CU-DN Porcine 127
MK510430 CO-AN-CC-DN Poultry 2
MK581207 CO-AN-CG-DN Poultry 208
MH051845 CO-AN-CC-RN Porcine 2
MK887109 CO-AN-CC-DN Poultry 1
MK217373 CO-AN-CG-DN Porcine 177
MK937832 CO-AN-CG-DN Porcine 192
MF280390 CO-AN-CG-DN Porcine 116
MK510438 CO-AN-CC-DN Poultry 2
MK887112 CO-AN-CC-DN Poultry 0
MN173789 CO-AN-CC-DN Porcine 0
MK510433 CO-AN-CC-DN Poultry 3
MK887088 CO-AN-CC-DN Poultry 0
MK478383 CO-AN-CC-DN Porcine 1
MK510436 CO-AN-CC-DN Poultry 2
MK887086 CO-AN-CC-DN Poultry 0
MK887103 CO-AN-CC-DN Poultry 1
MN173804 CO-AN-CC-DN Porcine 1
MK040453 CO-AN-CC-DN Porcine 1
MN173784 CO-AN-CC-DN Porcine 0
MK887127 CO-AN-CC-DN Poultry 0
MF457628 CO-AN-CC-DN Porcine 0
MK574043 CO-AN-CG-DN Porcine 187
MF457623 CO-AN-CC-DN Porcine 0
MF457610 CO-AN-CC-DN Porcine 0
MK040451 CO-AN-CC-DN Porcine 0
MK510440 CO-AN-CC-DN Poultry 2
MG738720 CO-AN-CC-RN Porcine 0
MK071267 CO-AN-CG-DN Poultry 206
MN173790 CO-AN-CC-DN Porcine 0
MK887119 CO-AN-CC-DN Poultry 0
MK330604 CO-AN-CG-DN Porcine 126
MF924725 CO-AN-CG-DN Poultry 198
MN512438 CO-AN-CG-DN Poultry 206
MK887082 CO-AN-CC-DN Poultry 0
MF457598 CO-AN-CC-DN Porcine 0
MK887117 CO-AN-CC-DN Poultry 0
MK887132 CO-AN-CC-DN Poultry 0
MK887115 CO-AN-CC-DN Poultry 0
MF457625 CO-AN-CC-DN Porcine 0
MH181793 CO-AN-CG-DN Poultry 199
NC_039208 CO-AN-CG-DN Porcine 120
U04739 CO-AN-CC-DN Poultry 3
U26210 CO-AN-CC-DN Porcine 0
U26212 CO-AN-CC-DN Porcine 0
U26211 CO-AN-CC-DN Porcine 0
U04805 CO-AN-CC-DN Poultry 0
U26214 CO-AN-CC-DN Porcine 0
U26213 CO-AN-CC-DN Porcine 0


III. Closing Comments

The potential for future pandemics is obvious, as further elucidated below.

Closing Observation (1):

"...the molecular mechanisms underlying the majority of these cell death modes have not been thoroughly investigated ... Many viruses encode anti-apoptotic proteins that allow them to complete viral replication before destruction of the cell ... Some viruses ... encode proteins that block the autophagic pathway ... thereby protecting viruses from degradation"

(To kill or be killed: how viruses interact with the cell death machinery, Journal of Internal Medicine). As microbe hosts to viruses die, the cellular reproduction machinery will eventually cease (but before complete disfunction ensues, viruses can become replicated or become recombinant in whole or in part due to various degrees of machine malfunction).

Closing Observation (2):

"What About COVID-19?

TA: You already mentioned that SARS-CoV-2—the virus that causes COVID-19—is an envelope virus. Do we know how long SARS-CoV-2 could remain viable in a dead body?

Koci: I have not seen any studies on this specifically. There are so few labs around the world with the type of building safeguards to work with this virus, and right now they are all focused on making vaccines or trying to find antiviral drugs that might work. However, we can make some educated guesses based on what we know from other viruses. A lot of what we know about virus survival in bodies comes from food animals. The outbreaks of major diseases in poultry or livestock can cause massive economic damage, so a lot of research goes into managing these events. A big part of that research is making sure that we don't spread the disease around by accident as we're cleaning farms and removing carcasses. In studies looking at how bird flu (avian influenza virus, an enveloped virus) survives in chicken carcasses, 90% of the virus was inactivated in around 15 days when the carcass was left at room temperature. But if the carcass was held at refrigerator temperatures (4C/40F), the virus lasted 4.5 times longer—that's more than two months. That 15-day timeframe at room temperature was for tests looking for the virus in muscle. The 90% inactivation timeframe was around 10 days in feathers and was less than a day in the liver, at room temperature. ...

Finding Evidence of a Virus

TA: How long would it be possible to detect a virus in a dead body, regardless of whether it poses a health risk? For example, would we be able to examine animal or human remains 10 years from now to better estimate the impact of COVID-19?

Koci: This is great question and an important distinction, because most of the data we have about SARS-Cov-2 survival is actually from a laboratory test called reverse-transcriptase polymerase chain reaction, or RT-PCR for short. This lab test detects the presence of the virus's genome. Genomes will be there whether the virus can still infect you or not. This type of test is a lot more sensitive than the tests used to detect infectious virus. If you've been tested, or you've seen video of people getting the nasal swab with that 4-foot-long Q-tip, that swab collects samples for the RT-PCR test. ... Then in 1997 the H5N1 avian flu emerged. And while it was devastating to poultry, it was also able to infect and kill people. We had never seen a flu virus jump straight from birds to people before. Could that have been how 1918 started? Could there be clues in the 1918 virus that would tell us what to look for in new strains of flu that would give us early warning of a new pandemic strain? So the 1918 virus was resurrected to try and understand what made that pandemic worse than others in the hopes of helping us be better prepared for the next one."

(How long can viruses survive in a dead body?, Medical Express, emphasis added). In other words, a decades old virus (that was inactive in dead tissue) was reactivated (why can't that happen to the virus segments in recent specimens ... who says they can't reactivate?).

Closing Observation (3):

"Because the birds are forced to breathe ammonia and particulate matter from feces and feathers all day long, many suffer from serious health problems, including chronic respiratory illnesses and bacterial infections.

Consumer Reports found that two-thirds of chicken meat analyzed was infected with salmonella or campylobacter—or both. The extremely high prevalence of dangerous contaminants in chicken flesh is largely from the filthy conditions in the sheds where the birds are raised. Factory-farmed animals are fed sub-therapeutic doses of antibiotics as “growth promoters.” Feeding animals low doses of antibiotics encourages the development of antibiotic-resistant bacteria—which people come into contact with when they handle or consume infected meat.

In addition to drugs, genetic selection is also used to make chickens grow faster and larger. The average chicken today is four times bigger than one in the 1950s, and chicken breasts are 80 percent larger than they were back then. Many chickens become crippled because their legs cannot support the weight of their bodies. It’s common for chickens to die from ascites, a disease thought to be caused by the inability of birds’ hearts and lungs to keep up with their rapid skeletal growth."

(The Chicken Industry, emphasis added). What could go wrong?

The next post in this series is here, the previous post in this series is here.