On The Origin Of The Home Of COVID-19 - 6

Microbe Whisperers

I. Introduction

In today's post we will take a look at a SARS-CoV-2 (a.k.a. Covid-19) nucleobase/nucleic acid sequences 'map' from a human in the state of Washington, U.S.A.

It will be compared to about 500 samples of nucleobase/nucleic acid sequences 'maps' taken from the rumen (first stomach) of cows in the U.S.A. and elsewhere.

Many such nucleotide maps are stored at Genbank, and are available for downloading.

A nucleotide in fasta format map looks like:

[description]
GTTTTTTTGTGTTGCCGGTCAAAACGCGATGACGTTCCCGCCTCTTCCCGTTCCCGGCAC
AGAGCCCTAAGCGTCACCACGGCGACGGTCAGCGACATGGGAAGGCGCAGGTAACCGCCC
CCTAAGAGGGAGTCACTGTTAAAACAGCGGCTCCCTCGTTTTTTTGTTGCCGGTCAAAGC
GCGATGACGTTCCCGCCTTTTCCCGTTCCTGGCACAGAGCCCTAAGCATCACCACGGCGA
CGGTCAGCGACATGGGAAGGCGTAGGTAACCGCCCCCTAAGAGAGGTGATGTCAGCAATG
ATGTCGCCTCTCGTTTTTTTGTTGCCGGTCAAAACGCGATGACGTTCCCGCCTCTTCCCG
TTCCTGGCACAGAGCCCTAAGCGTCACCACGGCGACGGTCAGCGACATGGGAAGGCGCAG
GTAACCGCCCCCTAAGAGGGAGTCACTGGTAAAACAGCGGCTCCCTCGTTTTTTTGTGTC
CTGTAGAAGCTATAGTTTTTATAACTACTATAGGGTGTCATGGTTGTGGGTTGTTTTTGC
TTTGAGATTGGCGTTGTTTGTTTTTTTTTAGTAATTTAGCATCGTTATCATTCGTAATTA
ATAACCAGAATTAAGATAAAATATTAAAAATGAAGCATTTAATATCTATCTTGCTGTTGC
...

(see fasta format). Human and microbe nucleotide maps "look the same" in one sense, however, the sequences are different even though there may be 'segments' or 'sections' that match between species.

This can happen in recombinant emergence situations, and it can cause major changes in the hosts in which such changes take place.

Consider placental mammals for example:

"If not for a virus, none of us [placental human mammals] would ever be born.

In 2000, a team of Boston scientists discovered a peculiar gene in the human genome. It encoded a protein made only by cells in the placenta. They called it syncytin.

The cells that made syncytin were located only where the placenta made contact with the uterus. They fuse together to create a single cellular layer, called the syncytiotrophoblast, which is essential to a fetus for drawing nutrients from its mother. The scientists discovered that in order to fuse together, the cells must first make syncytin.

What made syncytin peculiar was that it was not a human gene. It bore all the hallmarks of a gene from a virus."

(The Uncertain Gene - 5, cf. Retroviruses turned egg-layers into live-bearers, The placenta goes viral: Retroviruses control gene expression in pregnancy). What? Virus nucleobases in humans, virus genes that give us a start at life so to speak?

As it turns out, one of the likely homes of Covid-19 is going to be a surprise (Compendium of 4,941 rumen metagenome-assembled genomes for rumen microbiome biology and enzyme discovery).

II. The Comparison Experiment

So, as I said, we are going to look for human Covid-19 nucleotide segments in cow nucleotide/nucleic acid sequences maps.

This is important because cattle are a big part of our food production system.

The report of what I found in the search via software modules I developed is contained in Appendices A-F as follows:

Nucleobase Comparison	Appendix Location
1 - 6	Appendix A
9 - 15	Appendix B
16 - 22	Appendix C
23 - 30	Appendix D
31 - 37	Appendix E
38 - 51	Appendix F

The number of matches between segments of SARS-CoV-2 and segments of microbes in cow rumens might surprise you as it did me.

III. How The Results Were Derived

After downloading SARS-CoV-2 and bovine nucleobases/nucleic acid sequences I wrote software to iterate through the SARS-CoV-2 human nucleobase/nucleic acid sequences example from Washington, one ten-base-segment at a time.

The comparisons then take place while searching through ten bovine nucleobases/nucleic acid sequences (0000 - 0009) per bovine data file.

The search is for that particular SARS-CoV-2 segment in those bovine rumen nucleobases/nucleic acid sequences in each bovine data file.

The results in Appendices A-F give rise to some interesting inferences (got comments? got questions?).

IV. Closing Comments

I think that the hypothesis of this series is bolstered by the results of this SARS-CoV-2 vs. Bovine nucleobase/nucleic acid sequences comparison experiment.

The next post in this series is here, previous post in this series is here.

---

---