Saturday, May 31, 2025

Genetic Constants In DNA and RNA

What?

I. Problems? What Problems?

What is the cause of difficulties in analyzing DNA and RNA sequences?

The accuracy of collection samples is a serious problem:

"A computer-aided analysis of almost 12,000 human-genetics papers has found more than 700 studies with errors in the DNA or RNA sequences of their experimental reagents1. That amounts to a “problem of alarming proportions”, because it suggests that a worrying fraction of studies on human genes are not reliable, says the team that conducted the analysis, led by cancer researcher Jennifer Byrne at the University of Sydney in Australia."

(Nature, "Errors in genetic sequences", 2021; cf. this). But beyond that there is also:

"The problem of the creation of numerical constants has haunted the Genetic Programming (GP) community for a long time and is still considered one of the principal open research issues. Many problems tackled by GP include finding mathematical formulas, which often contain numerical constants."

(Creation of Numerical Constants in Robust Gene Expression Programming). As a Dylan song lyric indicates "You can't win with a losing hand" (Things Have Changed).

And since the "dealers who hand out the cards" ... 'cards' which are the hundreds of thousands of genetic sequences (e.g. GenBank), it would be nice to have a simple (by comparison) method of scanning the sequence data to find diversions from official values.

II. A Place To Begin

The basics to take note of are that the DNA sequences are composed of "ACTG" nucleotides for DNA contrasted with "ACUG" for RNA.



DNA:

(Adenine)  'A' = "C5H5N5" (5 Carbon, 5 Hydrogen, 5 Nitrogen)

(Cytocine) 'C' = "C4H5N3O1" (4 Carbon, 5 Hydrogen, 3 Nitrogen, 1 Oxygen)

(Thymine) 'T' = "C5H6N2O2" (5 Carbon, 6 Hydrogen, 2 Nitrogen, 2 Oxygen)

(Guanine)  'G' = "C5H5N5O1" (5 Carbon, 5 Hydrogen, 5 Nitrogen, 1 Oxygen)

DNA molecules contain 59 atoms


Carbon Atoms in DNA molecules
(Adenine5,Cytocine4,Thymine5,Guanine5) = 19
19÷59 = 0.322033898
a DNA molecule is 32.2033898 percent Carbon

Hydrogen Atoms in DNA molecules
(Adenine5,Cytocine5,Thymine6,Guanine5) = 21
21÷59 = 0.355932203
a DNA molecule is 35.5932203 percent Hydrogen

Nitrogen Atoms in DNA molecules
(Adenine5,Cytocine3,Thymine2,Guanine5) = 15
15÷59 = 0.254237288
a DNA molecule is 25.4237288 percent Nitrogen

Oxygen Atoms in DNA molecules
(Adenine0,Cytocine1,Thymine2,Guanine1) = 4
4÷59 = 0.06779661
a DNA molecule is 6.779661 percent Oxygen

Thus, the DNA Genetic Constant:
32.2033898 + 35.5932203 + 25.4237288 + 6.779661 = 99.9999999



RNA:

(Adenine)  'A' = "C5H5N5" (5 Carbon, 5 Hydrogen, 5 Nitrogen)

(Cytocine) 'C' = "C4H5N3O1" (4 Carbon, 5 Hydrogen, 3 Nitrogen, 1 Oxygen)

(Uracil) 'U' = "C4H4N2O2" (4 Carbon, 4 Hydrogen, 2 Nitrogen, 2 Oxygen)

(Guanine)  'G' = "C5H5N5O1" (5 Carbon, 5 Hydrogen, 5 Nitrogen, 1 Oxygen)

RNA molecules contain 56 atoms 


Carbon Atoms in RNA molecules
(Adenine5,Cytocine4,Uracil4,Guanine5) = 18
18÷56 = 0.321428571
an RNA molecule is 32.1428571 percent Carbon

Hydrogen Atoms in RNA molecules
(Adenine5,Cytocine5,Uracil4,Guanine5) = 19
19÷56 = 0.339285714
an RNA molecule is 33.9285714 percent Hydrogen


Nitrogen Atoms in RNA molecules
(Adenine5,Cytocine3,Uracil2,Guanine5) = 15
15÷56 = 0.267857143 
an RNA molecule is 26.7857143 percent Nitrogen

Oxygen Atoms in RNA molecules
(Adenine0,Cytocine1,Uracil2,Guanine1) = 4
4÷56 = 0.071428571
an RNA molecule is 7.1428571 percent Oxygen

Thus, the RNA Genetic Constant:
32.1428571 + 33.9285714 + 26.7857143 + 7.1428571 = 99.9999999



III. Using These Constants

There are many examples of the use of these constants in previous series, including both DNA  (On The Origin Of A Genetic Constant, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13), and RNA (On The Origin Of Another Genetic Constant, 2, 3, 4, 5).

The basic process, using GenBank "FASTA" format sequences, is to:

 1) load the entire sequence into your software analyzer

2) count the individual 'A', 'C', 'T', 'G' (for DNA; 'T'='U' for RNA) in that sequence

3) sum those individual atom counts 

4) divide that sum by the total atoms count (section IV. below)

A general example is found in a previous post appendix where the results of a scan of Cuculus Canorus is detailed (Appendix Cuckoo Chromosomes).

Here is a section from that large sequence in FASTA format:

>NC_071419.1 Cuculus canorus isolate bCucCan1 chromosome 19
TAACCCTAACCCTAAACCCTAAGCCTAACCCTAACCCTACCCTAACCCTAACCCTAACCAAACCCATAAC
CTACCCTAACCCTAACCCTAACCCTAACCATAAACCTAACCCCTAACCCTAAACCCTAAACCCTAACCCG
AACCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCCTAACCCTAAAC
CCTAACCACTAAAACCCTAACCCTAACCCTAAACCCTAACCCTAACCCTAACCCTAACCTAACCCTACCA
CCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCTAACCCTACCCTACCCCTAA
CCCTAACCCTAACCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCTAACCCTAACCCTAA
CCCCTAACCCTAACCCTAAACCTAACCCTAACCCTAACCCTAACCCTAACCCTACCCTAACCCTAACCCT
AACCCTAACCCTAACCCTAACCCTAACCCTAACCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCC
TAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTAAC
...

The process is to consider each 'A' 'C' 'G' and 'T' in DNA sequences or 'A' 'C' 'G' and 'U' in RNA sequences to chronicle the total atom count:

each "(Adenine)  'A' = "C5H5N5" (5 Carbon, 5 Hydrogen, 5 Nitrogen)";

each "(Cytocine) 'C' = "C4H5N3O1" (4 Carbon, 5 Hydrogen, 3 Nitrogen, 1 Oxygen);

each "(Guanine)  'G' = "C5H5N5O1" (5 Carbon, 5 Hydrogen, 5 Nitrogen, 1 Oxygen)"

each  "(Thymine) 'T' = "C5H6N2O2" (5 Carbon, 6 Hydrogen, 2 Nitrogen, 2 Oxygen)";

Sometimes there are 'N' letters in the sequence:

"How to handle 'N' in Nucleotide/Genes Sequences retrieved from NCBI GeneBank?

We know that the four native bases for DNA are AGTC, however, some of the sequences, retrieved from NCBI, contain letter 'N', which illustrates that these nucleotide bases are not deciphered correctly, leaving an unidentified nucleotide. Should I replace N with any other base i.e. AGTC, assuming N can be any nucleotide, or I should exclude such sequences assuming that the sequencing done was not of good quality. If none of these, what I can do with such sequences in my dataset?
P.S I can't find any help in Entrez Sequences Help Catalog."

(ResearchGate, cf. SEQanswers). The number of unknown nucleotides ('N') is usually small, but can be a large enough percentage  to require more analysis.

IV. ... And Then

When all is said and done useful percentages can be derived by dividing the total atom count "188,585,905" into each atom type's count:

carbon count: 60,816,461 ÷ 188,585,905 = 35.25%

hydrogen count: 67,198,608 ÷ 188,585,905 = 35.63%

nitrogen count: 47,829,318 ÷ 188,585,905 = 25.36%

oxygen count:  12,741,518 ÷ 188,585,905 = 6.76%

As shown in the following "Table 1" from that appendix:



Full Genome
Table: 1
Link and genome info: NC_071419.1
Cuculus canorus isolate bCucCan1 chromosome 19
bCucCan1.pri, whole genome shotgun sequence


Nucleotide count: 12,779,222
'N' Nucleotide Count: 300

Atom Atom Count Percent
Carbon 60,816,461 32.25
Hydrogen 67,198,608 35.63
Nitrogen 47,829,318 25.36
Oxygen 12,741,518 6.76
Totals 188,585,905 100.00

Finally, after taking note of the 'N' count ("'N' Nucleotide Count: 300") and it's percentage, the degree to which the sequence percents deviate from the official percents can be considered and compared to the official values:

"the DNA Genetic Constant:
32.2033898 + 35.5932203 + 25.4237288 + 6.779661 

So, we can calculate the deviation as:

carbon (32.25 - 32.2033898 = 0.0466102) 4.66102%; 

hydrogen (35.63 - 35.5932203 = 0.0367797) 3.67797%; 

nitrogen (25.36 - 25.4237288 = −0.0637288) -6.37288%; 

oxygen (6.76 - 6.779661 = −0.019661) -1.9661%.

The appendices in the On The Origin Of A Genetic Constant and On The Origin Of Another Genetic Constant have thousands of such examples taken from scores of different flora, fauna, humans, viruses, and microbes.

V. Closing Comments

The quality required in genetic sequences will vary with the type of project being considered.

For example, DNA in a murder case in a criminal court would seem to require more accuracy in the sequences at issue than determining DNA content of ancient mummies would.

Anyway, give me a shout at https://dreddblog@gmail.com if need be.

(Thanks to Christie L. Mills for editing this post, and others, for grammar).

The next post in this series is here.

Thursday, May 29, 2025

Here Come De Conservative Judges - 16

"Only we can do it".
We now have a federal court case that will continue to ask the question asked 16 years ago: "Will they be activists?". 

The Trump Executive Orders that imposed tariffs,  without any congressional act granting the right to do so, were all struck down in a "summary judgment" of a federal court:

"CONCLUSION

The court holds for the foregoing reasons that IEEPA does not authorize any of the Worldwide, Retaliatory, or Trafficking Tariff Orders. The Worldwide and Retaliatory Tariff Orders exceed any authority granted to the President by IEEPA to regulate importation by means of tariffs. The Trafficking Tariffs fail because they do not deal with the threats set forth in those orders. This conclusion entitles Plaintiffs to judgment as a matter of law; as the court further finds no genuine dispute as to any material fact, summary judgment will enter against the United States. See USCIT R. 56. The challenged Tariff Orders will be vacated and their operation permanently enjoined."

(UNITED STATES COURT OF INTERNATIONAL TRADE, emphasis added; cf video below). 

This will test the degenerative path on steroids which the US Supreme Court has been constructing for several years now (Here Come De Conservative Judges, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15).

Hold on to your hats (remember the Roe v Wade and Trump criminal immunity judicial earthquakes).

UPDATE: The decision was appealed to The Court of Appeals For the Federal Circuit.

That court has specialty jurisdiction different from, for instance, the Court of Appeals for the District of Columbia and the numbered circuits (e.g. First Circuit thru Tenth Circuit):

"The Federal Circuit is unique among the thirteen Circuit Courts
of Appeals. It has nationwide jurisdiction in a variety of subject areas,
including international trade, government contracts, patents, trademarks,
certain money claims against the United States government, federal
personnel, veterans’ benefits, and public safety officers’ benefits claims.
Appeals to the court come from all federal district courts, the United
States Court of Federal Claims, the United States Court of International
Trade, and the United States Court of Appeals for Veterans Claims. The
court also reviews certain administrative agency decisions, including
those from the U.S. Trademark Trial and Appeal Board, the U.S. Patent
trial and Appeal Board, the Boards of Contract Appeals, the U.S. Merit
Systems Protection Board, the Congressional Office of Compliance, the
Government Accountability Office Personnel Appeals Board, and the U.S.
International Trade Commission."

(Federal Circuit, PDF). My concern is that they do not specialize in constitutional issues like the federal appeals courts in the 13 federal circuits do, so their quickie ruling against the judgment of the Court of International Trade is puzzling.

The judges in the federal circuit appeals court have technical backgrounds in their educational experience.

The majority of the judges were appointed by President George W. Bush, President Clinton, President Obama, and one by President Biden.

I will read the briefs when the parties file them:

UPDATE:

"WASHINGTON (AP) — A federal appeals court agreed Tuesday to let the government keep collecting President Donald Trump’s sweeping import taxes while challenges to his signature trade policy continue on appeal.

The decision by the U.S. Court of Appeals for the Federal Circuit extends a similar ruling it made after another federal court struck down the tariffs May 28, saying Trump had overstepped his authority. Noting that the challenges to Trump’s tariffs raise “issues of exceptional importance,’' the appeals court said it would expedite the case and hear arguments July 31.

The case involves 10% tariffs the president imposed on almost every country in April and bigger ones he imposed and then suspended on countries with which the United States runs trade deficits. It also involves tariffs Trump plastered on imports from China, Canada and Mexico to pressure them to do more to stop the illegal flow of immigrants and synthetic opioids across the U.S. border.

In declaring the tariffs, Trump had invoked emergency powers under a 1977 law. But a three-judge panel of the U.S. Court of International Trade ruled he had exceeded his power.

The tariffs upended global trade, paralyzed businesses and spooked financial markets."

(AP News, 6/10/25).

The next post in this series is here, previous post in this series is here.