This is an appendix to: Human DNA Found In 2-3 Mya eDNA? - 8
The process for extracting DNA nucleotide segments from fastq files:
1) decompress the files (be careful, they may extract into a file named "data" which is not the full .gz file name. If the extracted file name is "data" rename it to the full .gz filename (e.g. rename the "data" file generated when "ERR10493278.fastq.gz" is decompressed, to the full name "ERR10493278.fastq"; repeat for all files downloaded).
2) Read the properly named fastq file one line at a time, ignoring all but the nucleotides line ... NOTE:
A FASTQ file has four line-separated fields per sequence:
Field 1 begins with a '@' character and is followed by a sequence identifier and an optional description (like a FASTA title line).
Field 2 is the raw sequence letters [i.e. DNA nucleotides, "the goodies"].
Field 3 begins with a '+' character and is optionally followed by the same sequence identifier (and any description) again.
Field 4 encodes the quality values for the sequence in Field 2, and must contain the same number of symbols as letters in the sequence.
So ... a FASTQ file looks like this:
@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65
(Wikipedia, Fastq Format).
3) Field 2 ("GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT") is the line to keep, discard (don't use) the other lines.
4) Append each new Field 2 nucleotides line into a growing-in-size line (lots of lines of Field 2 nucleotides making up one long line).
5) After adding each new line to the one long line, search the one long line for a promoter DNA ("TATAAA" see video) (when a promoter is found delete all nucleotides in the one long line preceding it).
6) keep reading nucleotide-only lines, appending them into one long line while searching for a terminator DNA ("TATCTC").
Note that the video below features one such sequence of nucleoties.
I vary the next steps, by searching for a DNA stop-codon ("TAA", "TAG", or "TGA") before searching for a DNA "start-codon" ("ATG") within the one long line.
That is because I now begin the "in frame" test, which involves inserting a "*" into the point just prior to the stop-codon in the one long line.
A "*TAA", "*TAG", or "*TGA" results which now marks the end of the sequence within the one long line. From that point I continue inserting a "*" before each 3-nucleotide set in the one long line (the direction of the "*" insertion is from stop-codon toward start-codon ... from end of the one long line toward its beginning).
After completing the "*" insertions, this is the way I know whether or not the sequence is "in frame" or not: if the beginning of the sequence now is "ATG*" it is "in frame", but if the beginning is now "A*TG" or "AT*G" it is "out of frame" and discarded.
7) Place a "bar char" ('|') at the beginning and at the end of the one long line.
Next, I search my SQL database tables (of start - stop sequences) for a match (examples of matches can be view in previous appendices: e.g. Appendix NGO).
No comments:
Post a Comment