9 Locus

This is an appendix to: Human DNA Found In 2-3 Mya eDNA? - 9

---

Concerning Project ENA PRJEB55522:

This appendix shows that segments of aeDNA in that project can be found in modern human DNA sequences stored in public databases.

---

NIH NUCCORE fasta file NW_013171802.1 nucleotide count = 249,228

ERR10493370 fastq aeDNA segment: "|ATG*GTG*CTG*GGA*AAA*CTG*GCT*AGC*CAT*ATG*TAG|"
a.k.a. ("ATGGTGCTGGGAAAACTGGCTAGCCATATGTAG")

was found at NW_013171802.1 nucleotide position 174,314

---

NIH NUCCORE fasta file NT_187543.1 nucleotide count = 496,813

ERR10493370 fastq aeDNA segment: "|ATG*GTG*CTG*GGA*AAA*CTG*GCT*AGC*CAT*ATG*TAG|"
a.k.a. ("ATGGTGCTGGGAAAACTGGCTAGCCATATGTAG")

was found at NT_187543.1 nucleotide position 174,314

and at NT_187543.1 nucleotide position 467,212

---

NIH NUCCORE fasta file NW_017363820.1 nucleotide count = 687,504

ERR10493370 fastq aeDNA segment: "|ATG*GTG*CTG*GGA*AAA*CTG*GCT*AGC*CAT*ATG*TAG|"
a.k.a. ("ATGGTGCTGGGAAAACTGGCTAGCCATATGTAG")

was found at NW_017363820.1 nucleotide position 174,314

and at NW_017363820.1 nucleotide position 467,212
and at NW_017363820.1 nucleotide position 665,674

---

NIH NUCCORE fasta file NW_003315915.1 nucleotide count = 1,069,067

ERR10493370 fastq aeDNA segment: "|ATG*GTG*CTG*GGA*AAA*CTG*GCT*AGC*CAT*ATG*TAG|"
a.k.a. ("ATGGTGCTGGGAAAACTGGCTAGCCATATGTAG")

was found at NW_003315915.1 nucleotide position 174,314

and at NW_003315915.1 nucleotide position 467,212
and at NW_003315915.1 nucleotide position 665,674

---

NIH NUCCORE fasta file NW_021160026.1 nucleotide count = 1,487,327

ERR10493370 fastq aeDNA segment: "|ATG*GTG*CTG*GGA*AAA*CTG*GCT*AGC*CAT*ATG*TAG|"
a.k.a. ("ATGGTGCTGGGAAAACTGGCTAGCCATATGTAG")

was found at NW_021160026.1 nucleotide position 174,314

and at NW_021160026.1 nucleotide position 467,212
and at NW_021160026.1 nucleotide position 665,674
and at NW_021160026.1 nucleotide position 1,152,364

---

NIH NUCCORE fasta file NW_025791757.1 nucleotide count = 1,700,761

ERR10493370 fastq aeDNA segment: "|ATG*GTG*CTG*GGA*AAA*CTG*GCT*AGC*CAT*ATG*TAG|"
a.k.a. ("ATGGTGCTGGGAAAACTGGCTAGCCATATGTAG")

was found at NW_025791757.1 nucleotide position 174,314

and at NW_025791757.1 nucleotide position 467,212
and at NW_025791757.1 nucleotide position 665,674
and at NW_025791757.1 nucleotide position 1,152,364
and at NW_025791757.1 nucleotide position 1,494,025

---

NIH NUCCORE fasta file NW_025791759.1 nucleotide count = 1,954,787

ERR10493370 fastq aeDNA segment: "|ATG*GTG*CTG*GGA*AAA*CTG*GCT*AGC*CAT*ATG*TAG|"
a.k.a. ("ATGGTGCTGGGAAAACTGGCTAGCCATATGTAG")

was found at NW_025791759.1 nucleotide position 174,314

and at NW_025791759.1 nucleotide position 467,212
and at NW_025791759.1 nucleotide position 665,674
and at NW_025791759.1 nucleotide position 1,152,364
and at NW_025791759.1 nucleotide position 1,494,025
and at NW_025791759.1 nucleotide position 1,781,445
and at NW_025791759.1 nucleotide position 1,867,542

---

NIH NUCCORE fasta file NT_187561.1 nucleotide count = 2,167,369

ERR10493370 fastq aeDNA segment: "|ATG*GTG*CTG*GGA*AAA*CTG*GCT*AGC*CAT*ATG*TAG|"
a.k.a. ("ATGGTGCTGGGAAAACTGGCTAGCCATATGTAG")

was found at NT_187561.1 nucleotide position 174,314

and at NT_187561.1 nucleotide position 467,212
and at NT_187561.1 nucleotide position 665,674
and at NT_187561.1 nucleotide position 1,152,364
and at NT_187561.1 nucleotide position 1,494,025
and at NT_187561.1 nucleotide position 1,781,445
and at NT_187561.1 nucleotide position 1,867,542
and at NT_187561.1 nucleotide position 2,095,742

---

NIH NUCCORE fasta file NW_025791765.1 nucleotide count = 3,136,102

ERR10493370 fastq aeDNA segment: "|ATG*GTG*CTG*GGA*AAA*CTG*GCT*AGC*CAT*ATG*TAG|"
a.k.a. ("ATGGTGCTGGGAAAACTGGCTAGCCATATGTAG")

was found at NW_025791765.1 nucleotide position 174,314

and at NW_025791765.1 nucleotide position 467,212
and at NW_025791765.1 nucleotide position 665,674
and at NW_025791765.1 nucleotide position 1,152,364
and at NW_025791765.1 nucleotide position 1,494,025
and at NW_025791765.1 nucleotide position 1,781,445
and at NW_025791765.1 nucleotide position 1,867,542
and at NW_025791765.1 nucleotide position 2,095,742
and at NW_025791765.1 nucleotide position 2,249,397
and at NW_025791765.1 nucleotide position 2,630,243

---

NIH NUCCORE fasta file NT_187420.1 nucleotide count = 3,533,765

ERR10493370 fastq aeDNA segment: "|ATG*GTG*CTG*GGA*AAA*CTG*GCT*AGC*CAT*ATG*TAG|"
a.k.a. ("ATGGTGCTGGGAAAACTGGCTAGCCATATGTAG")

was found at NT_187420.1 nucleotide position 174,314

and at NT_187420.1 nucleotide position 467,212
and at NT_187420.1 nucleotide position 665,674
and at NT_187420.1 nucleotide position 1,152,364
and at NT_187420.1 nucleotide position 1,494,025
and at NT_187420.1 nucleotide position 1,781,445
and at NT_187420.1 nucleotide position 1,867,542
and at NT_187420.1 nucleotide position 2,095,742
and at NT_187420.1 nucleotide position 2,249,397
and at NT_187420.1 nucleotide position 2,630,243
and at NT_187420.1 nucleotide position 3,336,143

---

NIH NUCCORE fasta file NW_003315909.1 nucleotide count = 3,659,356

ERR10493370 fastq aeDNA segment: "|ATG*GTG*CTG*GGA*AAA*CTG*GCT*AGC*CAT*ATG*TAG|"
a.k.a. ("ATGGTGCTGGGAAAACTGGCTAGCCATATGTAG")

was found at NW_003315909.1 nucleotide position 174,314

and at NW_003315909.1 nucleotide position 467,212
and at NW_003315909.1 nucleotide position 665,674
and at NW_003315909.1 nucleotide position 1,152,364
and at NW_003315909.1 nucleotide position 1,494,025
and at NW_003315909.1 nucleotide position 1,781,445
and at NW_003315909.1 nucleotide position 1,867,542
and at NW_003315909.1 nucleotide position 2,095,742
and at NW_003315909.1 nucleotide position 2,249,397
and at NW_003315909.1 nucleotide position 2,630,243
and at NW_003315909.1 nucleotide position 3,336,143
and at NW_003315909.1 nucleotide position 3,574,105

---

NIH NUCCORE fasta file NT_187530.1 nucleotide count = 4,133,194

ERR10493370 fastq aeDNA segment: "|ATG*GTG*CTG*GGA*AAA*CTG*GCT*AGC*CAT*ATG*TAG|"
a.k.a. ("ATGGTGCTGGGAAAACTGGCTAGCCATATGTAG")

was found at NT_187530.1 nucleotide position 174,314

and at NT_187530.1 nucleotide position 467,212
and at NT_187530.1 nucleotide position 665,674
and at NT_187530.1 nucleotide position 1,152,364
and at NT_187530.1 nucleotide position 1,494,025
and at NT_187530.1 nucleotide position 1,781,445
and at NT_187530.1 nucleotide position 1,867,542
and at NT_187530.1 nucleotide position 2,095,742
and at NT_187530.1 nucleotide position 2,249,397
and at NT_187530.1 nucleotide position 2,630,243
and at NT_187530.1 nucleotide position 3,336,143
and at NT_187530.1 nucleotide position 3,574,105

---

NIH NUCCORE fasta file NT_187679.1 nucleotide count = 4,696,934

ERR10493370 fastq aeDNA segment: "|ATG*GTG*CTG*GGA*AAA*CTG*GCT*AGC*CAT*ATG*TAG|"
a.k.a. ("ATGGTGCTGGGAAAACTGGCTAGCCATATGTAG")

was found at NT_187679.1 nucleotide position 174,314

and at NT_187679.1 nucleotide position 467,212
and at NT_187679.1 nucleotide position 665,674
and at NT_187679.1 nucleotide position 1,152,364
and at NT_187679.1 nucleotide position 1,494,025
and at NT_187679.1 nucleotide position 1,781,445
and at NT_187679.1 nucleotide position 1,867,542
and at NT_187679.1 nucleotide position 2,095,742
and at NT_187679.1 nucleotide position 2,249,397
and at NT_187679.1 nucleotide position 2,630,243
and at NT_187679.1 nucleotide position 3,336,143
and at NT_187679.1 nucleotide position 3,574,105
and at NT_187679.1 nucleotide position 4,667,334

---

NIH NUCCORE fasta file NW_003315935.1 nucleotide count = 5,011,163

ERR10493370 fastq aeDNA segment: "|ATG*GTG*CTG*GGA*AAA*CTG*GCT*AGC*CAT*ATG*TAG|"
a.k.a. ("ATGGTGCTGGGAAAACTGGCTAGCCATATGTAG")

was found at NW_003315935.1 nucleotide position 174,314

and at NW_003315935.1 nucleotide position 467,212
and at NW_003315935.1 nucleotide position 665,674
and at NW_003315935.1 nucleotide position 1,152,364
and at NW_003315935.1 nucleotide position 1,494,025
and at NW_003315935.1 nucleotide position 1,781,445
and at NW_003315935.1 nucleotide position 1,867,542
and at NW_003315935.1 nucleotide position 2,095,742
and at NW_003315935.1 nucleotide position 2,249,397
and at NW_003315935.1 nucleotide position 2,630,243
and at NW_003315935.1 nucleotide position 3,336,143
and at NW_003315935.1 nucleotide position 3,574,105
and at NW_003315935.1 nucleotide position 4,667,334
and at NW_003315935.1 nucleotide position 4,793,782

---

NIH NUCCORE fasta file NW_021160013.1 nucleotide count = 5,416,050

ERR10493370 fastq aeDNA segment: "|ATG*GTG*CTG*GGA*AAA*CTG*GCT*AGC*CAT*ATG*TAG|"
a.k.a. ("ATGGTGCTGGGAAAACTGGCTAGCCATATGTAG")

was found at NW_021160013.1 nucleotide position 174,314

and at NW_021160013.1 nucleotide position 467,212
and at NW_021160013.1 nucleotide position 665,674
and at NW_021160013.1 nucleotide position 1,152,364
and at NW_021160013.1 nucleotide position 1,494,025
and at NW_021160013.1 nucleotide position 1,781,445
and at NW_021160013.1 nucleotide position 1,867,542
and at NW_021160013.1 nucleotide position 2,095,742
and at NW_021160013.1 nucleotide position 2,249,397
and at NW_021160013.1 nucleotide position 2,630,243
and at NW_021160013.1 nucleotide position 3,336,143
and at NW_021160013.1 nucleotide position 3,574,105
and at NW_021160013.1 nucleotide position 4,667,334
and at NW_021160013.1 nucleotide position 4,793,782
and at NW_021160013.1 nucleotide position 5,075,641
and at NW_021160013.1 nucleotide position 5,099,986

---

NIH NUCCORE fasta file NW_025791807.1 nucleotide count = 5,754,573

ERR10493370 fastq aeDNA segment: "|ATG*GTG*CTG*GGA*AAA*CTG*GCT*AGC*CAT*ATG*TAG|"
a.k.a. ("ATGGTGCTGGGAAAACTGGCTAGCCATATGTAG")

was found at NW_025791807.1 nucleotide position 174,314

and at NW_025791807.1 nucleotide position 467,212
and at NW_025791807.1 nucleotide position 665,674
and at NW_025791807.1 nucleotide position 1,152,364
and at NW_025791807.1 nucleotide position 1,494,025
and at NW_025791807.1 nucleotide position 1,781,445
and at NW_025791807.1 nucleotide position 1,867,542
and at NW_025791807.1 nucleotide position 2,095,742
and at NW_025791807.1 nucleotide position 2,249,397
and at NW_025791807.1 nucleotide position 2,630,243
and at NW_025791807.1 nucleotide position 3,336,143
and at NW_025791807.1 nucleotide position 3,574,105
and at NW_025791807.1 nucleotide position 4,667,334
and at NW_025791807.1 nucleotide position 4,793,782
and at NW_025791807.1 nucleotide position 5,075,641
and at NW_025791807.1 nucleotide position 5,099,986

---

NIH NUCCORE fasta file NW_013171802.1 nucleotide count = 6,003,801

ERR10493370 fastq aeDNA segment: "|ATG*GTG*CTG*GGA*AAA*CTG*GCT*AGC*CAT*ATG*TAG|"
a.k.a. ("ATGGTGCTGGGAAAACTGGCTAGCCATATGTAG")

was found at NW_013171802.1 nucleotide position 174,314

and at NW_013171802.1 nucleotide position 467,212
and at NW_013171802.1 nucleotide position 665,674
and at NW_013171802.1 nucleotide position 1,152,364
and at NW_013171802.1 nucleotide position 1,494,025
and at NW_013171802.1 nucleotide position 1,781,445
and at NW_013171802.1 nucleotide position 1,867,542
and at NW_013171802.1 nucleotide position 2,095,742
and at NW_013171802.1 nucleotide position 2,249,397
and at NW_013171802.1 nucleotide position 2,630,243
and at NW_013171802.1 nucleotide position 3,336,143
and at NW_013171802.1 nucleotide position 3,574,105
and at NW_013171802.1 nucleotide position 4,667,334
and at NW_013171802.1 nucleotide position 4,793,782
and at NW_013171802.1 nucleotide position 5,075,641
and at NW_013171802.1 nucleotide position 5,099,986
and at NW_013171802.1 nucleotide position 5,928,887

---

NIH NUCCORE fasta file NT_187543.1 nucleotide count = 6,251,386

ERR10493370 fastq aeDNA segment: "|ATG*GTG*CTG*GGA*AAA*CTG*GCT*AGC*CAT*ATG*TAG|"
a.k.a. ("ATGGTGCTGGGAAAACTGGCTAGCCATATGTAG")

was found at NT_187543.1 nucleotide position 174,314

and at NT_187543.1 nucleotide position 467,212
and at NT_187543.1 nucleotide position 665,674
and at NT_187543.1 nucleotide position 1,152,364
and at NT_187543.1 nucleotide position 1,494,025
and at NT_187543.1 nucleotide position 1,781,445
and at NT_187543.1 nucleotide position 1,867,542
and at NT_187543.1 nucleotide position 2,095,742
and at NT_187543.1 nucleotide position 2,249,397
and at NT_187543.1 nucleotide position 2,630,243
and at NT_187543.1 nucleotide position 3,336,143
and at NT_187543.1 nucleotide position 3,574,105
and at NT_187543.1 nucleotide position 4,667,334
and at NT_187543.1 nucleotide position 4,793,782
and at NT_187543.1 nucleotide position 5,075,641
and at NT_187543.1 nucleotide position 5,099,986
and at NT_187543.1 nucleotide position 5,928,887
and at NT_187543.1 nucleotide position 6,221,785

---

NIH NUCCORE fasta file NW_017363820.1 nucleotide count = 6,442,077

ERR10493370 fastq aeDNA segment: "|ATG*GTG*CTG*GGA*AAA*CTG*GCT*AGC*CAT*ATG*TAG|"
a.k.a. ("ATGGTGCTGGGAAAACTGGCTAGCCATATGTAG")

was found at NW_017363820.1 nucleotide position 174,314

and at NW_017363820.1 nucleotide position 467,212
and at NW_017363820.1 nucleotide position 665,674
and at NW_017363820.1 nucleotide position 1,152,364
and at NW_017363820.1 nucleotide position 1,494,025
and at NW_017363820.1 nucleotide position 1,781,445
and at NW_017363820.1 nucleotide position 1,867,542
and at NW_017363820.1 nucleotide position 2,095,742
and at NW_017363820.1 nucleotide position 2,249,397
and at NW_017363820.1 nucleotide position 2,630,243
and at NW_017363820.1 nucleotide position 3,336,143
and at NW_017363820.1 nucleotide position 3,574,105
and at NW_017363820.1 nucleotide position 4,667,334
and at NW_017363820.1 nucleotide position 4,793,782
and at NW_017363820.1 nucleotide position 5,075,641
and at NW_017363820.1 nucleotide position 5,099,986
and at NW_017363820.1 nucleotide position 5,928,887
and at NW_017363820.1 nucleotide position 6,221,785
and at NW_017363820.1 nucleotide position 6,420,247

---

NIH NUCCORE fasta file NW_003315915.1 nucleotide count = 6,823,640

ERR10493370 fastq aeDNA segment: "|ATG*GTG*CTG*GGA*AAA*CTG*GCT*AGC*CAT*ATG*TAG|"
a.k.a. ("ATGGTGCTGGGAAAACTGGCTAGCCATATGTAG")

was found at NW_003315915.1 nucleotide position 174,314

and at NW_003315915.1 nucleotide position 467,212
and at NW_003315915.1 nucleotide position 665,674
and at NW_003315915.1 nucleotide position 1,152,364
and at NW_003315915.1 nucleotide position 1,494,025
and at NW_003315915.1 nucleotide position 1,781,445
and at NW_003315915.1 nucleotide position 1,867,542
and at NW_003315915.1 nucleotide position 2,095,742
and at NW_003315915.1 nucleotide position 2,249,397
and at NW_003315915.1 nucleotide position 2,630,243
and at NW_003315915.1 nucleotide position 3,336,143
and at NW_003315915.1 nucleotide position 3,574,105
and at NW_003315915.1 nucleotide position 4,667,334
and at NW_003315915.1 nucleotide position 4,793,782
and at NW_003315915.1 nucleotide position 5,075,641
and at NW_003315915.1 nucleotide position 5,099,986
and at NW_003315915.1 nucleotide position 5,928,887
and at NW_003315915.1 nucleotide position 6,221,785
and at NW_003315915.1 nucleotide position 6,420,247

---

NIH NUCCORE fasta file NW_021160026.1 nucleotide count = 7,241,900

ERR10493370 fastq aeDNA segment: "|ATG*GTG*CTG*GGA*AAA*CTG*GCT*AGC*CAT*ATG*TAG|"
a.k.a. ("ATGGTGCTGGGAAAACTGGCTAGCCATATGTAG")

was found at NW_021160026.1 nucleotide position 174,314

and at NW_021160026.1 nucleotide position 467,212
and at NW_021160026.1 nucleotide position 665,674
and at NW_021160026.1 nucleotide position 1,152,364
and at NW_021160026.1 nucleotide position 1,494,025
and at NW_021160026.1 nucleotide position 1,781,445
and at NW_021160026.1 nucleotide position 1,867,542
and at NW_021160026.1 nucleotide position 2,095,742
and at NW_021160026.1 nucleotide position 2,249,397
and at NW_021160026.1 nucleotide position 2,630,243
and at NW_021160026.1 nucleotide position 3,336,143
and at NW_021160026.1 nucleotide position 3,574,105
and at NW_021160026.1 nucleotide position 4,667,334
and at NW_021160026.1 nucleotide position 4,793,782
and at NW_021160026.1 nucleotide position 5,075,641
and at NW_021160026.1 nucleotide position 5,099,986
and at NW_021160026.1 nucleotide position 5,928,887
and at NW_021160026.1 nucleotide position 6,221,785
and at NW_021160026.1 nucleotide position 6,420,247
and at NW_021160026.1 nucleotide position 6,906,937

---

NIH NUCCORE fasta file NW_025791757.1 nucleotide count = 7,455,334

ERR10493370 fastq aeDNA segment: "|ATG*GTG*CTG*GGA*AAA*CTG*GCT*AGC*CAT*ATG*TAG|"
a.k.a. ("ATGGTGCTGGGAAAACTGGCTAGCCATATGTAG")

was found at NW_025791757.1 nucleotide position 174,314

and at NW_025791757.1 nucleotide position 467,212
and at NW_025791757.1 nucleotide position 665,674
and at NW_025791757.1 nucleotide position 1,152,364
and at NW_025791757.1 nucleotide position 1,494,025
and at NW_025791757.1 nucleotide position 1,781,445
and at NW_025791757.1 nucleotide position 1,867,542
and at NW_025791757.1 nucleotide position 2,095,742
and at NW_025791757.1 nucleotide position 2,249,397
and at NW_025791757.1 nucleotide position 2,630,243
and at NW_025791757.1 nucleotide position 3,336,143
and at NW_025791757.1 nucleotide position 3,574,105
and at NW_025791757.1 nucleotide position 4,667,334
and at NW_025791757.1 nucleotide position 4,793,782
and at NW_025791757.1 nucleotide position 5,075,641
and at NW_025791757.1 nucleotide position 5,099,986
and at NW_025791757.1 nucleotide position 5,928,887
and at NW_025791757.1 nucleotide position 6,221,785
and at NW_025791757.1 nucleotide position 6,420,247
and at NW_025791757.1 nucleotide position 6,906,937
and at NW_025791757.1 nucleotide position 7,248,598

---

NIH NUCCORE fasta file NW_025791759.1 nucleotide count = 7,709,360

ERR10493370 fastq aeDNA segment: "|ATG*GTG*CTG*GGA*AAA*CTG*GCT*AGC*CAT*ATG*TAG|"
a.k.a. ("ATGGTGCTGGGAAAACTGGCTAGCCATATGTAG")

was found at NW_025791759.1 nucleotide position 174,314

and at NW_025791759.1 nucleotide position 467,212
and at NW_025791759.1 nucleotide position 665,674
and at NW_025791759.1 nucleotide position 1,152,364
and at NW_025791759.1 nucleotide position 1,494,025
and at NW_025791759.1 nucleotide position 1,781,445
and at NW_025791759.1 nucleotide position 1,867,542
and at NW_025791759.1 nucleotide position 2,095,742
and at NW_025791759.1 nucleotide position 2,249,397
and at NW_025791759.1 nucleotide position 2,630,243
and at NW_025791759.1 nucleotide position 3,336,143
and at NW_025791759.1 nucleotide position 3,574,105
and at NW_025791759.1 nucleotide position 4,667,334
and at NW_025791759.1 nucleotide position 4,793,782
and at NW_025791759.1 nucleotide position 5,075,641
and at NW_025791759.1 nucleotide position 5,099,986
and at NW_025791759.1 nucleotide position 5,928,887
and at NW_025791759.1 nucleotide position 6,221,785
and at NW_025791759.1 nucleotide position 6,420,247
and at NW_025791759.1 nucleotide position 6,906,937
and at NW_025791759.1 nucleotide position 7,248,598
and at NW_025791759.1 nucleotide position 7,536,018
and at NW_025791759.1 nucleotide position 7,622,115

---

NIH NUCCORE fasta file NT_187561.1 nucleotide count = 7,921,942

ERR10493370 fastq aeDNA segment: "|ATG*GTG*CTG*GGA*AAA*CTG*GCT*AGC*CAT*ATG*TAG|"
a.k.a. ("ATGGTGCTGGGAAAACTGGCTAGCCATATGTAG")

was found at NT_187561.1 nucleotide position 174,314

and at NT_187561.1 nucleotide position 467,212
and at NT_187561.1 nucleotide position 665,674
and at NT_187561.1 nucleotide position 1,152,364
and at NT_187561.1 nucleotide position 1,494,025
and at NT_187561.1 nucleotide position 1,781,445
and at NT_187561.1 nucleotide position 1,867,542
and at NT_187561.1 nucleotide position 2,095,742
and at NT_187561.1 nucleotide position 2,249,397
and at NT_187561.1 nucleotide position 2,630,243
and at NT_187561.1 nucleotide position 3,336,143
and at NT_187561.1 nucleotide position 3,574,105
and at NT_187561.1 nucleotide position 4,667,334
and at NT_187561.1 nucleotide position 4,793,782
and at NT_187561.1 nucleotide position 5,075,641
and at NT_187561.1 nucleotide position 5,099,986
and at NT_187561.1 nucleotide position 5,928,887
and at NT_187561.1 nucleotide position 6,221,785
and at NT_187561.1 nucleotide position 6,420,247
and at NT_187561.1 nucleotide position 6,906,937
and at NT_187561.1 nucleotide position 7,248,598
and at NT_187561.1 nucleotide position 7,536,018
and at NT_187561.1 nucleotide position 7,622,115
and at NT_187561.1 nucleotide position 7,850,315

---

NIH NUCCORE fasta file NW_025791765.1 nucleotide count = 8,890,675

ERR10493370 fastq aeDNA segment: "|ATG*GTG*CTG*GGA*AAA*CTG*GCT*AGC*CAT*ATG*TAG|"
a.k.a. ("ATGGTGCTGGGAAAACTGGCTAGCCATATGTAG")

was found at NW_025791765.1 nucleotide position 174,314

and at NW_025791765.1 nucleotide position 467,212
and at NW_025791765.1 nucleotide position 665,674
and at NW_025791765.1 nucleotide position 1,152,364
and at NW_025791765.1 nucleotide position 1,494,025
and at NW_025791765.1 nucleotide position 1,781,445
and at NW_025791765.1 nucleotide position 1,867,542
and at NW_025791765.1 nucleotide position 2,095,742
and at NW_025791765.1 nucleotide position 2,249,397
and at NW_025791765.1 nucleotide position 2,630,243
and at NW_025791765.1 nucleotide position 3,336,143
and at NW_025791765.1 nucleotide position 3,574,105
and at NW_025791765.1 nucleotide position 4,667,334
and at NW_025791765.1 nucleotide position 4,793,782
and at NW_025791765.1 nucleotide position 5,075,641
and at NW_025791765.1 nucleotide position 5,099,986
and at NW_025791765.1 nucleotide position 5,928,887
and at NW_025791765.1 nucleotide position 6,221,785
and at NW_025791765.1 nucleotide position 6,420,247
and at NW_025791765.1 nucleotide position 6,906,937
and at NW_025791765.1 nucleotide position 7,248,598
and at NW_025791765.1 nucleotide position 7,536,018
and at NW_025791765.1 nucleotide position 7,622,115
and at NW_025791765.1 nucleotide position 7,850,315
and at NW_025791765.1 nucleotide position 8,003,970
and at NW_025791765.1 nucleotide position 8,384,816

---

NIH NUCCORE fasta file NT_187420.1 nucleotide count = 9,288,338

ERR10493370 fastq aeDNA segment: "|ATG*GTG*CTG*GGA*AAA*CTG*GCT*AGC*CAT*ATG*TAG|"
a.k.a. ("ATGGTGCTGGGAAAACTGGCTAGCCATATGTAG")

was found at NT_187420.1 nucleotide position 174,314

and at NT_187420.1 nucleotide position 467,212
and at NT_187420.1 nucleotide position 665,674
and at NT_187420.1 nucleotide position 1,152,364
and at NT_187420.1 nucleotide position 1,494,025
and at NT_187420.1 nucleotide position 1,781,445
and at NT_187420.1 nucleotide position 1,867,542
and at NT_187420.1 nucleotide position 2,095,742
and at NT_187420.1 nucleotide position 2,249,397
and at NT_187420.1 nucleotide position 2,630,243
and at NT_187420.1 nucleotide position 3,336,143
and at NT_187420.1 nucleotide position 3,574,105
and at NT_187420.1 nucleotide position 4,667,334
and at NT_187420.1 nucleotide position 4,793,782
and at NT_187420.1 nucleotide position 5,075,641
and at NT_187420.1 nucleotide position 5,099,986
and at NT_187420.1 nucleotide position 5,928,887
and at NT_187420.1 nucleotide position 6,221,785
and at NT_187420.1 nucleotide position 6,420,247
and at NT_187420.1 nucleotide position 6,906,937
and at NT_187420.1 nucleotide position 7,248,598
and at NT_187420.1 nucleotide position 7,536,018
and at NT_187420.1 nucleotide position 7,622,115
and at NT_187420.1 nucleotide position 7,850,315
and at NT_187420.1 nucleotide position 8,003,970
and at NT_187420.1 nucleotide position 8,384,816
and at NT_187420.1 nucleotide position 9,090,716

---

NIH NUCCORE fasta file NW_003315909.1 nucleotide count = 9,413,929

ERR10493370 fastq aeDNA segment: "|ATG*GTG*CTG*GGA*AAA*CTG*GCT*AGC*CAT*ATG*TAG|"
a.k.a. ("ATGGTGCTGGGAAAACTGGCTAGCCATATGTAG")

was found at NW_003315909.1 nucleotide position 174,314

and at NW_003315909.1 nucleotide position 467,212
and at NW_003315909.1 nucleotide position 665,674
and at NW_003315909.1 nucleotide position 1,152,364
and at NW_003315909.1 nucleotide position 1,494,025
and at NW_003315909.1 nucleotide position 1,781,445
and at NW_003315909.1 nucleotide position 1,867,542
and at NW_003315909.1 nucleotide position 2,095,742
and at NW_003315909.1 nucleotide position 2,249,397
and at NW_003315909.1 nucleotide position 2,630,243
and at NW_003315909.1 nucleotide position 3,336,143
and at NW_003315909.1 nucleotide position 3,574,105
and at NW_003315909.1 nucleotide position 4,667,334
and at NW_003315909.1 nucleotide position 4,793,782
and at NW_003315909.1 nucleotide position 5,075,641
and at NW_003315909.1 nucleotide position 5,099,986
and at NW_003315909.1 nucleotide position 5,928,887
and at NW_003315909.1 nucleotide position 6,221,785
and at NW_003315909.1 nucleotide position 6,420,247
and at NW_003315909.1 nucleotide position 6,906,937
and at NW_003315909.1 nucleotide position 7,248,598
and at NW_003315909.1 nucleotide position 7,536,018
and at NW_003315909.1 nucleotide position 7,622,115
and at NW_003315909.1 nucleotide position 7,850,315
and at NW_003315909.1 nucleotide position 8,003,970
and at NW_003315909.1 nucleotide position 8,384,816
and at NW_003315909.1 nucleotide position 9,090,716
and at NW_003315909.1 nucleotide position 9,328,678

---

NIH NUCCORE fasta file NT_187567.1 nucleotide count = 10,517,422

ERR10493370 fastq aeDNA segment: "|ATG*GAA*ACT*GAA*CAA*CCT*GCT*CCT*GAA*TGA|"
a.k.a. ("ATGGAAACTGAACAACCTGCTCCTGAATGA")

was found at NT_187567.1 nucleotide position 1,144,500

and at NT_187567.1 nucleotide position 1,779,367
and at NT_187567.1 nucleotide position 1,911,232
and at NT_187567.1 nucleotide position 2,628,160
and at NT_187567.1 nucleotide position 3,044,651
and at NT_187567.1 nucleotide position 3,334,061
and at NT_187567.1 nucleotide position 3,589,246
and at NT_187567.1 nucleotide position 4,868,433
and at NT_187567.1 nucleotide position 6,899,073
and at NT_187567.1 nucleotide position 7,533,940
and at NT_187567.1 nucleotide position 7,665,805
and at NT_187567.1 nucleotide position 8,382,733
and at NT_187567.1 nucleotide position 8,799,224
and at NT_187567.1 nucleotide position 9,088,634
and at NT_187567.1 nucleotide position 9,343,819
and at NT_187567.1 nucleotide position 10,302,325
and at NT_187567.1 nucleotide position 10,336,465

---

NIH NUCCORE fasta file NW_009646204.1 nucleotide count = 10,731,820

ERR10493370 fastq aeDNA segment: "|ATG*GAA*ACT*GAA*CAA*CCT*GCT*CCT*GAA*TGA|"
a.k.a. ("ATGGAAACTGAACAACCTGCTCCTGAATGA")

was found at NW_009646204.1 nucleotide position 1,144,500

and at NW_009646204.1 nucleotide position 1,779,367
and at NW_009646204.1 nucleotide position 1,911,232
and at NW_009646204.1 nucleotide position 2,628,160
and at NW_009646204.1 nucleotide position 3,044,651
and at NW_009646204.1 nucleotide position 3,334,061
and at NW_009646204.1 nucleotide position 3,589,246
and at NW_009646204.1 nucleotide position 4,868,433
and at NW_009646204.1 nucleotide position 6,899,073
and at NW_009646204.1 nucleotide position 7,533,940
and at NW_009646204.1 nucleotide position 7,665,805
and at NW_009646204.1 nucleotide position 8,382,733
and at NW_009646204.1 nucleotide position 8,799,224
and at NW_009646204.1 nucleotide position 9,088,634
and at NW_009646204.1 nucleotide position 9,343,819
and at NW_009646204.1 nucleotide position 10,302,325
and at NW_009646204.1 nucleotide position 10,336,465
and at NW_009646204.1 nucleotide position 10,648,852

---

NIH NUCCORE fasta file NW_021160027.1 nucleotide count = 11,140,708

ERR10493370 fastq aeDNA segment: "|ATG*GAA*ACT*GAA*CAA*CCT*GCT*CCT*GAA*TGA|"
a.k.a. ("ATGGAAACTGAACAACCTGCTCCTGAATGA")

was found at NW_021160027.1 nucleotide position 1,144,500

and at NW_021160027.1 nucleotide position 1,779,367
and at NW_021160027.1 nucleotide position 1,911,232
and at NW_021160027.1 nucleotide position 2,628,160
and at NW_021160027.1 nucleotide position 3,044,651
and at NW_021160027.1 nucleotide position 3,334,061
and at NW_021160027.1 nucleotide position 3,589,246
and at NW_021160027.1 nucleotide position 4,868,433
and at NW_021160027.1 nucleotide position 6,899,073
and at NW_021160027.1 nucleotide position 7,533,940
and at NW_021160027.1 nucleotide position 7,665,805
and at NW_021160027.1 nucleotide position 8,382,733
and at NW_021160027.1 nucleotide position 8,799,224
and at NW_021160027.1 nucleotide position 9,088,634
and at NW_021160027.1 nucleotide position 9,343,819
and at NW_021160027.1 nucleotide position 10,302,325
and at NW_021160027.1 nucleotide position 10,336,465
and at NW_021160027.1 nucleotide position 10,648,852

---

NIH NUCCORE fasta file NW_003315909.1 nucleotide count = 11,266,299

ERR10493370 fastq aeDNA segment: "|ATG*GAA*ACT*GAA*CAA*CCT*GCT*CCT*GAA*TGA|"
a.k.a. ("ATGGAAACTGAACAACCTGCTCCTGAATGA")

was found at NW_003315909.1 nucleotide position 1,144,500

and at NW_003315909.1 nucleotide position 1,779,367
and at NW_003315909.1 nucleotide position 1,911,232
and at NW_003315909.1 nucleotide position 2,628,160
and at NW_003315909.1 nucleotide position 3,044,651
and at NW_003315909.1 nucleotide position 3,334,061
and at NW_003315909.1 nucleotide position 3,589,246
and at NW_003315909.1 nucleotide position 4,868,433
and at NW_003315909.1 nucleotide position 6,899,073
and at NW_003315909.1 nucleotide position 7,533,940
and at NW_003315909.1 nucleotide position 7,665,805
and at NW_003315909.1 nucleotide position 8,382,733
and at NW_003315909.1 nucleotide position 8,799,224
and at NW_003315909.1 nucleotide position 9,088,634
and at NW_003315909.1 nucleotide position 9,343,819
and at NW_003315909.1 nucleotide position 10,302,325
and at NW_003315909.1 nucleotide position 10,336,465
and at NW_003315909.1 nucleotide position 10,648,852
and at NW_003315909.1 nucleotide position 11,196,189

---

NIH NUCCORE fasta file NT_187567.1 nucleotide count = 12,007,928

ERR10493370 fastq aeDNA segment: "|ATG*GAA*ACT*GAA*CAA*CCT*GCT*CCT*GAA*TGA|"
a.k.a. ("ATGGAAACTGAACAACCTGCTCCTGAATGA")

was found at NT_187567.1 nucleotide position 1,144,500

and at NT_187567.1 nucleotide position 1,779,367
and at NT_187567.1 nucleotide position 1,911,232
and at NT_187567.1 nucleotide position 2,628,160
and at NT_187567.1 nucleotide position 3,044,651
and at NT_187567.1 nucleotide position 3,334,061
and at NT_187567.1 nucleotide position 3,589,246
and at NT_187567.1 nucleotide position 4,868,433
and at NT_187567.1 nucleotide position 6,899,073
and at NT_187567.1 nucleotide position 7,533,940
and at NT_187567.1 nucleotide position 7,665,805
and at NT_187567.1 nucleotide position 8,382,733
and at NT_187567.1 nucleotide position 8,799,224
and at NT_187567.1 nucleotide position 9,088,634
and at NT_187567.1 nucleotide position 9,343,819
and at NT_187567.1 nucleotide position 10,302,325
and at NT_187567.1 nucleotide position 10,336,465
and at NT_187567.1 nucleotide position 10,648,852
and at NT_187567.1 nucleotide position 11,196,189
and at NT_187567.1 nucleotide position 11,792,831
and at NT_187567.1 nucleotide position 11,826,971

---

NIH NUCCORE fasta file NW_009646204.1 nucleotide count = 12,222,326

ERR10493370 fastq aeDNA segment: "|ATG*GAA*ACT*GAA*CAA*CCT*GCT*CCT*GAA*TGA|"
a.k.a. ("ATGGAAACTGAACAACCTGCTCCTGAATGA")

was found at NW_009646204.1 nucleotide position 1,144,500

and at NW_009646204.1 nucleotide position 1,779,367
and at NW_009646204.1 nucleotide position 1,911,232
and at NW_009646204.1 nucleotide position 2,628,160
and at NW_009646204.1 nucleotide position 3,044,651
and at NW_009646204.1 nucleotide position 3,334,061
and at NW_009646204.1 nucleotide position 3,589,246
and at NW_009646204.1 nucleotide position 4,868,433
and at NW_009646204.1 nucleotide position 6,899,073
and at NW_009646204.1 nucleotide position 7,533,940
and at NW_009646204.1 nucleotide position 7,665,805
and at NW_009646204.1 nucleotide position 8,382,733
and at NW_009646204.1 nucleotide position 8,799,224
and at NW_009646204.1 nucleotide position 9,088,634
and at NW_009646204.1 nucleotide position 9,343,819
and at NW_009646204.1 nucleotide position 10,302,325
and at NW_009646204.1 nucleotide position 10,336,465
and at NW_009646204.1 nucleotide position 10,648,852
and at NW_009646204.1 nucleotide position 11,196,189
and at NW_009646204.1 nucleotide position 11,792,831
and at NW_009646204.1 nucleotide position 11,826,971
and at NW_009646204.1 nucleotide position 12,139,358

---

NIH NUCCORE fasta file NW_021160027.1 nucleotide count = 12,631,214

ERR10493370 fastq aeDNA segment: "|ATG*GAA*ACT*GAA*CAA*CCT*GCT*CCT*GAA*TGA|"
a.k.a. ("ATGGAAACTGAACAACCTGCTCCTGAATGA")

was found at NW_021160027.1 nucleotide position 1,144,500

and at NW_021160027.1 nucleotide position 1,779,367
and at NW_021160027.1 nucleotide position 1,911,232
and at NW_021160027.1 nucleotide position 2,628,160
and at NW_021160027.1 nucleotide position 3,044,651
and at NW_021160027.1 nucleotide position 3,334,061
and at NW_021160027.1 nucleotide position 3,589,246
and at NW_021160027.1 nucleotide position 4,868,433
and at NW_021160027.1 nucleotide position 6,899,073
and at NW_021160027.1 nucleotide position 7,533,940
and at NW_021160027.1 nucleotide position 7,665,805
and at NW_021160027.1 nucleotide position 8,382,733
and at NW_021160027.1 nucleotide position 8,799,224
and at NW_021160027.1 nucleotide position 9,088,634
and at NW_021160027.1 nucleotide position 9,343,819
and at NW_021160027.1 nucleotide position 10,302,325
and at NW_021160027.1 nucleotide position 10,336,465
and at NW_021160027.1 nucleotide position 10,648,852
and at NW_021160027.1 nucleotide position 11,196,189
and at NW_021160027.1 nucleotide position 11,792,831
and at NW_021160027.1 nucleotide position 11,826,971
and at NW_021160027.1 nucleotide position 12,139,358

---

NIH NUCCORE fasta file NW_003315909.1 nucleotide count = 12,756,805

ERR10493370 fastq aeDNA segment: "|ATG*GAA*ACT*GAA*CAA*CCT*GCT*CCT*GAA*TGA|"
a.k.a. ("ATGGAAACTGAACAACCTGCTCCTGAATGA")

was found at NW_003315909.1 nucleotide position 1,144,500

and at NW_003315909.1 nucleotide position 1,779,367
and at NW_003315909.1 nucleotide position 1,911,232
and at NW_003315909.1 nucleotide position 2,628,160
and at NW_003315909.1 nucleotide position 3,044,651
and at NW_003315909.1 nucleotide position 3,334,061
and at NW_003315909.1 nucleotide position 3,589,246
and at NW_003315909.1 nucleotide position 4,868,433
and at NW_003315909.1 nucleotide position 6,899,073
and at NW_003315909.1 nucleotide position 7,533,940
and at NW_003315909.1 nucleotide position 7,665,805
and at NW_003315909.1 nucleotide position 8,382,733
and at NW_003315909.1 nucleotide position 8,799,224
and at NW_003315909.1 nucleotide position 9,088,634
and at NW_003315909.1 nucleotide position 9,343,819
and at NW_003315909.1 nucleotide position 10,302,325
and at NW_003315909.1 nucleotide position 10,336,465
and at NW_003315909.1 nucleotide position 10,648,852
and at NW_003315909.1 nucleotide position 11,196,189
and at NW_003315909.1 nucleotide position 11,792,831
and at NW_003315909.1 nucleotide position 11,826,971
and at NW_003315909.1 nucleotide position 12,139,358
and at NW_003315909.1 nucleotide position 12,686,695

---