Wednesday, July 8, 2026

The Uncertain Gene - 12

It isn't alive
In a recent series it was noted that some genetic DNA of humans was found in 2-3 million year old eDNA in Greenland (Human DNA Found In 2-3 Mya eDNA?,  2).

It stimulated me to look into genetic DNA of ancient mummies of Egypt and Eurasia.

And elsewhere (The Origins of Human Beings According to Ancient Sumerian Texts, Ancient Humans Bred with Completely Unknown Species), Initial DNA analysis of Paracas elongated skull released – with incredible results).

There are gigabytes of files detailing sequences of that DNA.

So, I built a C++ program that parses the huge gigabyte files of nucleotides and first extracts tataboxes, then extracts mRNA sections from the tataboxes (see video below if you haven't already).

This is the process:

"When searching for sections of DNA in other DNA the software prepares the nucleotides so that partial segments can't be confused one for the other (see the example in the video below).

First you isolate a tatabox section by finding a promoter (TATAAA) and a terminator (TATCTC) segment:

TATAAAATGGCCGAGCGGTCTAAGGCGCTGC
GTTCAGGTCGCAGTCTCCCCTGGAGGCGTGG
GTTCGAATCCCACTCCTGATATCTCTATCTC 

Next erase the promoter and terminator from the string of nucleotides: 

ATGGCCGAGCGGTCTAAGGCGCTGC
GTTCAGGTCGCAGTCTCCCCTGGAGGCGTGG
GTTCGAATCCCACTCCTGA

Next, sequentially go thru the strand placing a '*' every third location

ATG*GCC*GAG*CGG*TCT*AAG*GCG*CTG*C
GT*TCA*GGT*CGC*AGT*CTC*CCC*TGG*AGG*CGT*GG
G*TTC*GAA*TCC*CAC*TCC*TGA

Then you look within that segment for a start codon (ATG) and one of three stop codons (TAA, TGA,TAG).

The ATG begins the transcription sequence, and the first (closest one following the start codon) instance of a stop codon ends the in-frame string of nucleotides. 

I do this to avoid what is described as an "out of frame" event that messes things up.

If there aren't three nucleotides separated by '*' then the strand is "not in-frame".

I store them in the SQL database with the '*' characters in place to preserve the proper arrangement. "

(Human DNA Found In 2-3 Mya eDNA?). Being extremely cautious avoids jumping "out of frame".

The overall process is to read all of the human DNA segments into one long string (millions of nucleotides), then load the Egyptian and Eurasian segments one at a time, searching the human string for each one.

The results are in Appendix One. 

The previous post in this series is here. 



1 comment:

  1. "It all started in the ‘90s on a research boat in the middle of the ocean. Zehr was an oceanographer studying nitrogen-fixing bacteria — simple, microbial life forms that could pull the element straight from the air, making it bioavailable to plants and animals. Scientists at the time had only seriously studied one species of nitrogen-fixing bacteria in the entire ocean, but Zehr wanted to change that. His plan was to gather and test samples of seawater with the hope that he might find something that other scientists had missed.Zehr’s plans involved something pretty cutting-edge for the time: DNA. He gathered seawater samples and ran tests for the presence of the gene for nitrogenase, the enzyme that gives bacteria the ability to pull nitrogen out of the air. If he got a hit, it would hopefully mean the seawater contained some new kind of nitrogen-fixing bacteria. And it worked. Almost immediately, he found traces of a species of nitrogen-fixing bacteria previously unknown to science" (The ... that wasn't there).

    ReplyDelete