Genetic Constants In DNA and RNA - 5

Fig. 1 DNA Base Pairs

DNA genetic sequences such as FASTA or GBFF do not show nucleotides in the way DNA graphics do (Fig. 1).  

Instead, they are just a list of individual nucleotides with no exclusive Base pair lineup:

"TAAATACTGGCAAGGGATGATATGG
AACGTGCCTTTATTGGGTGTAGTGA
TAGGCGGAGCTTTATGGGCTTTGTT
CGCAGGTGTACTGGGTTGGCTTAT"

(Alteromonas macleodii first 100 nucleotides, Base pairs emphasized). In the graphs the bonds are emphasized, but not in the sequences.

In the previous post a new test was added to the list of tests to perform on a DNA sequence so as to get a look and feel for its accuracy.

This additional test, like the previous ones, involves simple arithmetic too.

In this case that arithmetic is subtraction.

All you have do is compare the a_count to the t_count or the c_count to the g_count.

Next subtract the smaller value from the larger value to derive the difference.

If there is no difference that is as it should be because in the "Base pair" nomenclature the count must be the same according to Fig. 1 , dictionaries, etc. ("The total nuclear DNA in a single human cell is about three billion base pairs long" - link).:

pair: 

[1]: two corresponding things designed for use together [e.g.] a pair of shoes
[2]: two corresponding bodily parts or members [e.g.] a pair of hands
[3]: something made up of two corresponding pieces [e.g. a Base pair]

(Dictionary). "Base pair" in this case means an "A-T" or "T-A" pairing, or a "C-G" or "G-C" pairing.

In all cases the a_count must equal the t_count and the c_count must match the g_count or the sequence is flawed (or there are other canonical constructs, in addition to base pairs, but without Base pair bonding/binding). 

See the examples of actual genomes in the appendices analyzing homo sapien DNA wher the individual nucleotides are counted (Ancient Egypt, Ancient Eurasia, Modern Human, Miscellaneous Organisms).

Why the sequences are in different arrangements is not a subject of this series, but may be considered here.

The previous post in this series is here. 

---

---