 |
| Fig. 1 Transcription: DNA~>mRNA |
I. Introduction
Making a sequence of a virus genome is not as scientifically well-developed as one would think:
"Obtaining virus genome sequence directly from clinical samples is still a challenging task due to the low load of virus genetic material compared to the host DNA, and to the difficulty to get an accurate genome assembly."
(A complete protocol for whole-genome sequencing). The quote from that article indicates that the reasons for the difficulty are: 1) "due to the low load of virus genetic material compared to the host DNA", and 2) "the difficulty to get an accurate genome assembly" (ibid).
The article goes on to list how defects, which can appear to be 'mutations' or 'variants', happen all too often.
In a previous post in this series the Wuhan SARS-CoV-2 comparison to the Omicron 'variant' was questioned (It's In The GenBank - 4).
II. Big Pharma Virus Propaganda
Even the very nature of the virus realm is still foggy:
"Viruses have generally been characterized by their detrimental effects, particularly their pathogenic ones. Examples abound of human, animal, and plant viruses that reduce host fitness, and Section 2 below recalls that, given the number of past and present human deaths due to viruses, it is by no means surprising that viruses are generally perceived as harmful.
In that context, the recent claim that many viruses can in fact be mutualistic, i.e., have beneficial effects on host fitness, was a bombshell to many."
(Mutualistic viruses and the heteronomy of life). Within the realm where virus genomes are "defined" (using the money of Big Pharma; cf. Who Picks Up the Tab for Science?), some scientific definitions are changing:
"Viruses are being redefined as more than just pathogens. They are also critical symbiotic partners in the health of their hosts. In some cases, viruses have fused with their hosts in symbiogenetic relationships. Mutualistic interactions are found in plant, insect, and mammalian viruses, as well as with eukaryotic and prokaryotic microbes, and some interactions involve multiple players of the holobiont. With increased virus discovery, more mutualistic interactions are being described and more will undoubtedly be discovered."
(Viruses make their mark as mutualistic microbial symbionts). It is not a surprise that funding by "the powers that be" flows in directions that benefit the one funding the money ("I suspect the existence of what I call the `John Mercer effect' ... the scientists preaching caution and downplaying the dangers ... fared better in receipt of research funding." - Dr. James Hansen, link).
III. But I Digress
"All of the RNA in a cell is made by DNA transcription" (From DNA to RNA, emphasis added). So, the Wuhan SARS-CoV-2 RNA virus as well as the Omicron 'variant' RNA virus are made by a cell's DNA transcription machinery inside the cell nucleus as was pointed out in (On The Origin Of The Home Of COVID-19 - 29).
Getting back to the nucleotide sequences of viruses within their host microbe, let us revisit the comparison of the Wuhan SARS-CoV-2 virus nucleotide sequence with the Omicron 'variant' nucleotide sequence (ibid).
IV. What's Up With The
Wuhan/Omicron
GenBank Sequences?
The (Wuhan, Omicron) sequences in GenBank do not utilize the proper nucleotide nomenclature for RNA:
"DEFINITION Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome.
...
FEATURES Location/Qualifiers
source 1..29903
/organism="Severe acute respiratory syndrome coronavirus 2"
/mol_type="genomic RNA"
...
[FASTA version ]
ATTAAAGGTTTATACCTTCCCAGGTAACAAACCAACCAACTTTCGATCTC ..."
(Wuhan, emphasis added). The video below, and every other savvy source informs us that there are no "T" bases in RNA, those bases are only in "DNA".
Which means that the Wuhan and Omicron nucleotide sequences feature the DNA of the host that the SARS-CoV-2 RNA is in.
Which means that the mRNA transcription in the appendices of the aforesaid Dredd Blog post (Wuhan, "Mutants-Wuhan", Omicron, "Mutants-Omicron") feature the SARS-CoV-2 RNA!
It would be nice if the GenBank folks would clearly point that out in their .gbff and .fna files, rather than erroneously indicating that the "RNA genomes ... /mol_type=genomic RNA" are of a SARS-CoV-2 virus.
V. Closing Comments
Evidently these problems are going to be with us for a long time:
"A virus [SARS-CoV-2] that shows no signs of disappearing, variants that are adept at dodging the body’s defenses and waves of infections two, maybe three times a year — this may be the future of COVID-19, some scientists now fear."
(How Often Can You Be Infected With the Coronavirus?). As long as it takes?
The next post in this series is here, the previous post in this series is here.
