Sunday, June 28, 2026

Human DNA Found In 2-3 Mya eDNA?

Ancient human DNA found
on cave art for the first time

I. Foreward

In a Nature paper a while back (A 2-million-year-old ecosystem in Greenland uncovered by environmental DNA) environmental DNA (eDNA) was discussed.

I had looked at a more recent paper which also concerned eDNA:

Highlights • eDNA is a genetic mixture of different living organisms often referred to as a genetic shake. • eDNA approach is an environmentally friendly and non-invasive survey method. • eDNA represents all DNA present in the environment derived from biological tissue fragments and excrement. • eDNA metabarcoding characterizes the DNA of various species from a single eDNA sample.

(A systematic review on environmental DNA (eDNA) Science).  The ancient eDNA interested me most (cf. Abiology Or Quantum Biology? - 5), so I asked myself why not find "human eDNA"?

II. A Combo? 

The title of this series tells you what became an interest I wanted to share with Dredd Blog readers after I looked into the eDNA files from the Greenland project mentioned in the Nature paper above (located here).

I have downloaded about half of those files so far, and have processed the GCF_015227675.2_mRatBN7.2_genomic.fna.gz to extract FASTA chromosome files 1-20, X, and Y from it.

Next I loaded my modern human DNA files from my SQL database with a program I wrote.

It makes a "string" out of that human DNA for quicker searches (it is over 50 meg long).

That program then loads SQL tables composed of each of the chromosome files extracted from the GCF_015227675.2_mRatBN7.2 file.

I can report that four human DNA matches were found in the 2-3 million year old eDNA files as follows.

III. First Things First

When searching for sections of DNA in other DNA the software prepares the nucleotides so that partial segments can't be confused one for the other (see the example in the video below).

First you isolate a tatabox section by finding a promoter (TATAAA) and a terminator (TATCTC) segment:

TATAAAATGGCCGAGCGGTCTAAGGCGCTGC
GTTCAGGTCGCAGTCTCCCCTGGAGGCGTGG
GTTCGAATCCCACTCCTGATATCTCTATCTC 

Next erase the promoter and terminator from the string of nucleotides: 

ATGGCCGAGCGGTCTAAGGCGCTGC
GTTCAGGTCGCAGTCTCCCCTGGAGGCGTGG
GTTCGAATCCCACTCCTGA

Next, sequentially go thru the strand placing a '*' every third location

ATG*GCC*GAG*CGG*TCT*AAG*GCG*CTG*C
GT*TCA*GGT*CGC*AGT*CTC*CCC*TGG*AGG*CGT*GG
G*TTC*GAA*TCC*CAC*TCC*TGA

Then you look within that segment for a start codon (ATG) and one of three stop codons (TAA, TGA,TAG).

The ATG begins the transcription sequence, and the first (closest one following the start codon) instance of a stop codon ends the in-frame string of nucleotides. 

I do this to avoid what is described as an "out of frame" event that messes things up.

If there aren't three nucleotides separated by '*' then the strand is "not in-frame".

I store them in the SQL database with the '*' characters in place to preserve the proper arrangement. 

IV. Rats!

After looking up the sequence numbers found in file GCF_015227675.2_mRatBN7.2, significant questions are raised.

One is, how are Norwegian Rat DNA, sequenced in 2-3 million year old eDNA sequences found in a frozen Greenland sub-icecap realm,  related to these human DNA segments (see appendices A1, A2, A3)?

But I digress, on to the next huge DNA file from Greenland (here).




No comments:

Post a Comment