On The Origin Of The Home Of COVID-19 - 9

T4 backteriophage

I. Spooky

In the previous post I quoted from a researcher who pointed out that a virus in the dead flesh of a victim of the 1918 pandemic was reactivated in a lab circa 1997-98 (How long can viruses survive in a dead body?).

Some indicated that the dead flesh came from permafrost in the vast Alaska wilderness of that time, or in laboratories that had saved some of the flesh of victims here and there.

Wow, who woulda thunk it?

Other sources indicated that the viruses nucleotide sequence had been revealed, so I looked it up (The Deadliest Flu: The Complete Story of the Discovery and Reconstruction of the 1918 Pandemic Virus).

Not only that, I found a copy of the nucleotide sequence in fasta format, so, I just had to show it to Dredd Blog readers:

>gb: AF116575 | Organism: Influenza A virus (A / Brevig Mission / 1 / 1918(H1N1)) | Strain Name:A / Brevig Mission / 1/ 1918 | Segment:4 | Subtype:H1N1| Host: Human
ATGGAGGCAAGACTACTGGTCTTGTTATGTGCATTTGCAGCTACAAATGCAGACACAATATGTATAGGCT
ACCATGCGAATAACTCAACCGACACTGTTGACACAGTACTCGAAAAGAATGTGACCGTGACACACTCTGT
TAACCTGCTCGAAGACAGCCACAACGGAAAACTATGTAAATTAAAAGGAATAGCCCCATTACAATTGGGG
AAATGTAATATCGCCGGATGGCTCTTGGGAAACCCGGAATGCGATTTACTGCTCACAGCGAGCTCATGGT
CCTATATTGTAGAAACATCGAACTCAGAGAATGGAACATGTTACCCAGGAGATTTCATCGACTATGAAGA
ACTGAGGGAGCAATTGAGCTCAGTGTCATCGTTCGAAAAATTCGAAATATTTCCCAAGACAAGCTCGTGG
CCCAATCATGAAACAACCAAAGGTGTAACGGCAGCATGCTCCTATGCGGGAGCAAGCAGTTTTTACAGAA
ATTTGCTGTGGCTGACAAAGAAGGGAAGCTCATACCCAAAGCTTAGCAAGTCCTATGTGAACAATAAAGG
GAAAGAAGTCCTTGTACTATGGGGTGTTCATCATCCGCCTACCGGTACTGATCAACAGAGTCTCTATCAG
AATGCAGATGCTTATGTCTCTGTAGGGTCATCAAAATATAACAGGAGATTCACCCCGGAAATAGCAGCGA
GACCCAAAGTAAGAGATCAAGCTGGGAGGATGAACTATTACTGGACATTACTAGAACCCGGAGACACAAT
AACATTTGAGGCAACTGGAAATCTAATAGCACCATGGTATGCTTTCGCACTGAATAGAGGTTCTGGATCC
GGTATCATCACTTCAGACGCACCAGTGCATGATTGTAACACGAAGTGTCAAACACCCCATGGTGCTATAA
ACAGCAGTCTCCCTTTCCAGAATATACATCCAGTCACAATAGGAGAGTGCCCAAAATACGTCAGGAGTAC
CAAATTGAGGATGGCTACAGGACTAAGAAACATTCCATCTATTCAATCCAGGGGTCTATTTGGAGCCATT
GCCGGTTTTATTGAGGGGGGATGGACTGGAATGATAGATGGATGGTATGGTTATCATCATCAGAATGAAC
AGGGATCAGGCTATGCAGCGGATCAAAAAAGCACACAAAATGCCATTGACGGGATTACAAACAAGGTGAA
TTCTGTTATCGAGAAAATGAACACCCAATT

(Genome of the 1918 Pandemic causing virus, bold added). Having done that I decided to search for matches of genome segments of that virus in cow rumen.

The process is to search for a 10 segment sequence (the bold at the beginning of the sequence above shows the first one) of that 1918 pandemic virus.

It is the same process I had used with Sars-CoV-2 in cow rumen, poultry, swine, and bats (On The Origin Of The Home Of COVID-19, 2, 3, 4, 5, 6, 7, 8).

The bold section of ten bases is searched for first, a count is kept, then we move to the next ten bases, and so forth, keeping a tally as shown in Section II below.

The purpose is to see if any segments of that 1918 virus are in our current 'virusphere'.

If so, then we are talking about reassortment/recombinant viruses (RNA Virus Reassortment, Recombinant).

II. Searchin' Searchin' Searchin'

My software module searched hundreds of thousands of cow rumen nucleotide/genome datasets in files in the GenBank, and reported:

---

1918 Virus Bases ID: AF116575
(Organism: Influenza A virus
A/Brevig Mission/1/1918
Strain Name: A/Brevig Mission/1/1918
Host: Human virus type: H1N1)

Target bases to search:
Cow Rumen

Comparison Type:
1918 Virus segment = Rumen segment?

Search Results:

GenBank File Id	Segments in 1918 Virus	Genomes in Rumen File	1918 Virus Segments Found in Genomes	1918 Segments per Genome
10676_0040	122	295,166	10,983	26.8748
10676_0039	122	128,519	6,266	20.5105
10676_0010	122	787	855	0.920468
10676_0003	122	1,088	937	1.16115
10676_0011	122	176	282	0.624113
10676_0036	122	6,630	2,553	2.59694
10676_0046	122	42,643	5,391	7.91004
10676_0012	122	296	473	0.625793
10676_0022	122	87	186	0.467742
10676_0038	122	364,399	13,241	27.5205
10676_0049	122	64,980	6,150	10.5659
10676_0045	122	187,633	8592	21.8381
10676_0005	122	220,342	8,575	25.6959
10676_0037	122	117,147	7,505	15.6092
10676_0015	122	568	700	0.811429
10676_0002	122	245	424	0.57783
10676_0030	122	1,793	1,264	1.41851
10676_0041	122	53,535	5,979	8.95384
10676_0009	122	355,497	14,134	25.1519
10676_0019	122	138,641	6,497	21.3392
10676_0051	122	44,327	5,808	7.63206
10676_0029	122	7,539	2,376	3.17298
10676_0028	122	2,366	1,770	1.33672
10676_0018	122	9,976	3,092	3.22639
10676_0042	122	66,725	6,840	9.75512
10676_0021	122	437	627	0.69697
10676_0032	122	15,691	4,193	3.74219
10676_0013	122	192,309	9,732	19.7605
10676_0035	122	1,408	1,054	1.33586
10676_0001	122	119	215	0.553488
10676_0034	122	1,091	986	1.10649
10676_0004	122	772	827	0.933495
10676_0023	122	320,673	11,944	26.848
10676_0050	122	121,778	6,336	19.22
10676_0033	122	33,440	5,181	6.45435
10676_0014	122	230,170	9,615	23.9386
10676_0006	122	1,662	1,311	1.26773
10676_0024	122	405,094	14,710	27.5387
10676_0025	122	2,617	1,618	1.61743
10676_0048	122	38,609	6,462	5.97478
10676_0016	122	144,629	6,531	22.145
10676_0020	122	3,295	1,720	1.9157
10676_0031	122	36,897	4,728	7.80393
10676_0047	122	118,461	6,913	17.136
10676_0043	122	45,438	5,880	7.72755
10676_0027	122	103,080	5,830	17.681
10676_0017	122	10,564	2,882	3.66551

Per-file Average (47 files):

Genomes in Rumen File: 83,815.7
1918 Virus Segments Found in Genomes: 4,897.19
1918 Segments per Genome: 9.90128

---

III. Closing Comments

That report in Section II above is a perusal of a vast amount of data freely available at GenBank.

It is quite a story that a century-old virus could be reactivated, then put through the paces so that the genome could be captured for further scientific use.

And, so that Dredd Blog could go looking for it with modern software in the rumen of modern cattle.

A quote from one researcher caught my eye:

"The lessons we're learning today from COVID-19 build on the lessons we learned from the 1918 influenza. We aren't the apex predator we think we are. An organism 750 times smaller than the width of human hair can wreak havoc on us to rival most wars..."

(How long can viruses survive in a dead body?, bold added). The Sars-CoV-2 that causes COVID-19 has already rivaled WW1 and two Vietnam's.

The count in those wars took years to accumulate, in the case of Vietnam ten years.

This COVID-19 war-like landscape of dead bodies has only begun.

It is halfway through its first year.

The next post in this series is here, the previous post in this series is here.