Dredd Blog: 2023-12-03

Saturday, December 9, 2023

On The Origin Of Another Genetic Constant - 4

New and Improved!

This new constant discovery applies only to "TATA" boxes in genomes where transcription from DNA to mRNA takes place (TATA box).

The type of tata box featured today has a "TATAAA" promoter and a "TATCTC" terminator (see example below).

I processed about 9,500 FASTA files, excluding those without any tata boxes in them, to produce today's appendices.

The appendices contain the results and the variation quantities from the ~(32/35/25/6) genetic constant in human and various other genomes.

How the constant was isolated is shown here (On The Origin Of A Genetic Constant - 9).

The big news is that the tata box examples in the appendices match the variation values of entire genomes that were featured in previous posts (On The Origin Of A Genetic Constant, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10).

Here is the list of appendices (001, 002, 003, 004, 005, 006, 007, 008, 009, 010, 011, 012).

A sample tata box:

From organism Xenopus tropicalis: TATAAACTGGCACAGTTGCTATGGGTCCCTGAGCAGGGAGGCCGGG
ACACATGGGACCTTGGTTATGGCCCAGTCAGGGTTATACTCATAGGTTACACTGGGTAGGGTCAGGGCTGAGCAGCTTGA
GCTCCAGCGAGGAGATTCAGTGCGATTACTGCCCAGAGTAGGGACCCAGTGTACAGACCTAGGGCCAAAGAGACTTGGTG
GGGGGGTGACCCGTCATTACTGATCTAATTCTCTGCGCATTGATTGGCCCTGAGGGGCTGAGAATTGTGGGAAGGTATAA
CTGTAAGTGCCCCCTGTGTGAGGTACTTGCCCTGCTGCCCTGAGATGTAATAGTTAATAAGTCCTTGTTTGAGTTCAGAA
ACCCCTGCTGCCCATTATTGGTGTCTCAGAGTGAGAGATATAGTTGCACTACACCCTCCCCCCAATACATACCTGAGAGA
TTGCCCTGGTCTATGGAGTCCAGCCCCTTACAGTTCCTAATAACTAGGCGATTCCTTTACTTACTGAATGTCACCTTAGT
GAATGTCACCCTGAGGCGCAAATCAAACAGCGTTAAACTTTGCGCGACTCCGGTAGAAAACAAACGCGCTGCCGCCCTTG
TGGCCCCGGCACCAACTTTCCCTTTTATTCCCATTTCTTGTCTCAGTCGCTCCCCAAACAGCATTTATGTGCGGTAATGT
TATGCCCCCCCCATTAATGAAGGGAATGCGGAGACATAATAACAGGGTCCCCCAGGGGCCCCCCGGCTGCTTAGCATGTG
ACCGAGTCGCTGCGATTCCCCCGCTGTATAATGAGCCGCTACTTCAGGCAGAATGCGATATCAAAGGCGCCGGCGCTGCG
ACTCTGTGTCAGATTGCGCTTTCTGCCCCCTCCCTTCTACGTGAACTTGTGCCCCTGTCAGACATCTTAGGGAGGCTTGA
AACATAGGGCCCCCCCTCCTCGATACCTGCCCCCCCCGCTCCCTGGGGCCCCAACGGGACTCGCTTTGTGCAGCTTTTAA
CTTGATAAAGTTTAACGTTCTGAGCGAAGTGAGACCCCCCCGAGAAATGCTGCCCCCCAGTGTCACTCATCCAAAGGTTT
AACATTCTGAGCGAAGTGAGACCCCCGAGAAAATGCCTTGACCCCCCAGTGTCACTCATCCAAAGGTTTAACGTTCTGAG
CGAAGTGAGACCCCCCCAGATAAATGCTTGCCCCCAGTGTCACCTCTCAAAGGGTTTAACGTTCTGAGCGAAGTAGGAGG
ACCCCCAGAGAAATGCTGCCCCCTCCAGTGTTTCACTCAGTCCCAAAGTTACGTTCTGAGCGAAGTGAGACCCCCCCCAG
CGAGAAATGCTGCCCCCAGTGTCACTCTCCAAGGTTTAACGTTCTAGAGCGAAAGTGAGGACCCCCCGAGAAATGTGCCC
CCCAGTGTCAACTCATCCAAAGGTTTAACGTTTGACGAAGTGAAACCCCCCCCCCCGAGAAATGCTGCCCCCCAGTGTCA
CTCATCCAAAGGTTTAACATTCTGAGCGAAGTGAGACCCCCCCGAAATGCTGCCCCCCAGTGTCACTCATCCAAAGGTTT
AACGTTCTGAGCGAAGTGAGACCCCCCCCCGAGAAATGCTGCCCCCCAGTGTCACATCATCCAAAAGTTTAACTGTTCTC
GAGCGAAGTGAGACCCCCCGCCGAGAAATGCTGCCCCCCAGTGTCACTCAATCAAAGGTTAACGTTCTGAGCGAAGTGGA
CCCCCCCAGAGAAATGGGCTTGCCCCCCCAGTTGTCACTCATCAAAGGTTTAACGTACTGAGCGAAGTAGAGACCCCCCC
CCGAGAAAATGCTGCCGCCCAGTGGTGTCACTCATCCAAAGTTTCAACGTTCTGAGCGAAGTGAGACCCCCCCAGAGAAA
TGCCTGCCCCAGTGTCCAACTCACTCCAAAGGTTTAACGTTCTGAAGTGAAGTGAGACCCCCCCCAGAGAAAATGCTGCC
CCCAGTGTACTCATCCAAAGTTTAACGTCTGAGCGAGTGAGACCCCCCCCGAGAAATGCTGCCCCAGTGTCCACTCATCA
AAGGTTTAACGTTGCTGAGCGAAGTGAGACCCCCCCCAGAGAAATGGCTGCCCCAGTGTCACTCATCCAAAGTTTAACGT
CTGAGCGAAGTGAAGACCCCCCCGAGAAATGCTGCCCCCCAGTTACTCATCCAAAGGTTTAAGTTCTGACCGAAGTTGAG
ACCCCCCCCGAGACATGCTGCCCCCAGTTGTCACTCATCCAAGGTTAACATTCTGAAGACGAAGTGAGACCCCCCCAGAG
AAATCTGCCCAGTGGTCACTATTCCAAAGTTTAACGTTCTTGAGCGAAGTGAGACCCCCTCCCAGAGAAATGCTGCCCAG
TGTCACTCATCCAATAGGTTTAACATTCTGAGCGAGTGAGACCCCCAGAGGAGAATGCTTGCCCCCAGTGTCACTCATCC
AAAGGTTTAACTTCTGAGCGAAGTGAGACCCCCCAGAGAAAATTGCTGCCCCCAGTGTCACTCATCAAATAGGTTTTAAC
GTTACTGACGAAGTGAGACCCCCCCCCGAGAAATGCTAGCCCCCCAGTGTCACTCATCCAAGGTTTAACGTTCTTGATGC
GAGTTGAGACCCCCCCGATTAAATGCTGCCCCCCAGTGTCATCATCCAAAGGTTTAACGTCTCTGAGCGAAGTGCAGACC
CCCCCGAAGAAAAAGCTGGCCCCCCGAGTTCACTCATCCAAGGTTTTACGTTCTGAGCGAAGTGAGAACCCCCCCGAGAA
TGCTGCCCCCCAGTGTCACTCATCAAAGTTTAACGTCTGAGCGAAGTGAGACCCGCCCCCAGAGAACTGCTGCCCCCCAG
TGGTCACTCATTCCAAAGGTGTAACGTGCTGAGCGAAGTGGACCCCCCCAGAAGAAAAATGCTGCCCCAGTCGTGTCACT
CTCCAAAGGTTTTAACGTTTGAGCGAAGTGGAACCCCCCCGGAAATGCTGCCCCCAGTGTCATCATTCAAGGTTTACGTT
CTGAGCGAAGTTGAGACCCCTCCGAGAGAAATGCTGCCCCCAGTGTCATCATCGAAAAAATGTTTTTAACGTTCTGAGCG
AAGTGAGACCCCCCAGGAAACTGCTGCCCCAGTGTCACTCATCAAGGTTTAACGTTCTGAGCAAGTGAGACCCCCCCCCT
GAGAAATGCTGCCCCCAGTGTCACCTCATCCAAAGTTTAACATTCTAGCGAAGTGGACCCCCCGAGTTAAATGCTGCCCC
CAGTGTCACTCATCCAAAGGTTAAGTGTTCTGAGCGAAGTGAGACCCCCCGAGAAATGCTGCCCCCCAGTGTCACTCATA
CAAAGGTTTAACGTTTCGAGCGAAGTGAGACCCCCCAGAGAAATGCTGCCCCCCAGGTCACTATCCAAAGGTTTAACGTT
CTGGAGCGAAGTGGACCCCCCAGAGAAAATGCTGCCCCCAGTGTCACTCATCCAAAGGTTTAACGTTACCTGGAGCGAAG
TTGAGACCCCCCCAGAGAAATGACTGCCCCCATGTCACTCATCCAAGTGGCCCCATCTCTTCCTGTATTTATACAGACTG
TGTGAGGTGCGGAACTACTACTCCCTGCCTCACAGGAGCTTACACTTTACTCAGCTCCACCCCATACCCCCCCTAATGTC
ACCCAGTGTCGGACTGGGACCCCGAGGGCCACCAGAAAACCTTAGACCCTAGTCCCCCTCTCCCAACTATATCTC

The video below points out the dynamics involved.

The previous post in this series is here.

Appendix 012

This is an appendix to: On The Origin Of Another Genetic Constant - 4

DNA Constant Values:
(for calculating variations
in the tables below)

Carbon: 32.2034%
Hydrogen: 35.5932%
Nitrogen: 25.4237%
Oxygen: 6.7797%

Promoter-Terminator Sections
Table: 5501 (Promoter Count: 46)
Link and genome info: NW_003315968.2
Homo sapiens chromosome 21 genomic scaffold
GRCh38.p14 alternate locus group ALT_REF_LOCI_1 HSCHR21_2_CTG1_1

Nucleotide count: 156,465
Atom	Atom Count	Percent	Variation %
Carbon	755,905	32.56	> ~0.3521
Hydrogen	833,917	35.92	> ~0.3222
Nitrogen	574,709	24.75	< ~0.6720
Oxygen	157,364	6.78	< ~0.0023
Totals	2,321,895	100.00	----

Promoter-Terminator Sections
Table: 5502 (Promoter Count: 1)
Link and genome info: KN150483.1
Danio rerio unplaced genomic contig NA831
GRCz11 reference primary assembly

Nucleotide count: 10,252
'N' Nucleotide Count: 400
Atom	Atom Count	Percent	Variation %
Carbon	49,231	32.55	> ~0.3469
Hydrogen	54,073	35.75	> ~0.1585
Nitrogen	38,763	25.63	> ~0.2054
Oxygen	9,179	6.07	< ~0.7108
Totals	151,246	100.00	----

Promoter-Terminator Sections
Table: 5503 (Promoter Count: 7)
Link and genome info: NKLS02000185.1
Bos taurus breed Hereford isolate L1 Dominette 01449 registration number 42190680 Leftover_ScbfJmS_116
whole genome shotgun sequence

Nucleotide count: 27,721
Atom	Atom Count	Percent	Variation %
Carbon	133,541	32.49	> ~0.2854
Hydrogen	147,948	35.99	> ~0.4006
Nitrogen	100,448	24.44	< ~0.9860
Oxygen	29,100	7.08	> ~0.3000
Totals	411,037	100.00	----

Promoter-Terminator Sections
Table: 5504 (Promoter Count: 1)
Link and genome info: AAMC04000071.1
Xenopus tropicalis strain Nigerian Sca61
whole genome shotgun sequence

Nucleotide count: 371
Atom	Atom Count	Percent	Variation %
Carbon	1,803	32.60	> ~0.3947
Hydrogen	1,967	35.56	< ~0.0300
Nitrogen	1,415	25.58	> ~0.1594
Oxygen	346	6.26	< ~0.5241
Totals	5,531	100.00	----

Promoter-Terminator Sections
Table: 5505 (Promoter Count: 40)
Link and genome info: NW_018394875.1
Danio rerio strain Tuebingen chromosome 13 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG13_1_16

Nucleotide count: 256,595
Atom	Atom Count	Percent	Variation %
Carbon	1,237,530	32.54	> ~0.3391
Hydrogen	1,365,642	35.91	> ~0.3182
Nitrogen	944,084	24.83	< ~0.5978
Oxygen	255,557	6.72	< ~0.0595
Totals	3,802,813	100.00	----

Promoter-Terminator Sections
Table: 5506 (Promoter Count: 1)
Link and genome info: NW_003336761.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA1

Nucleotide count: 11,040
'N' Nucleotide Count: 100
Atom	Atom Count	Percent	Variation %
Carbon	53,068	32.47	> ~0.2676
Hydrogen	58,669	35.90	> ~0.3049
Nitrogen	40,529	24.80	< ~0.6250
Oxygen	11,166	6.83	> ~0.0525
Totals	163,432	100.00	----

Promoter-Terminator Sections
Table: 5507 (Promoter Count: 4)
Link and genome info: NW_021160011.1
Homo sapiens chromosome 13 genomic patch of type FIX
GRCh38.p14 PATCHES HG1524_PATCH

Nucleotide count: 21,050
Atom	Atom Count	Percent	Variation %
Carbon	99,877	32.16	< ~0.0416
Hydrogen	110,358	35.54	< ~0.0563
Nitrogen	79,180	25.50	> ~0.0734
Oxygen	21,130	6.80	> ~0.0245
Totals	310,545	100.00	----

Promoter-Terminator Sections
Table: 5508 (Promoter Count: 26)
Link and genome info: KZ114935.1
Danio rerio chromosome 13 genomic contig ALT_CTG13_2_6
GRCz11 reference assembly alternate locus group ALT_DRER_TU_2

Nucleotide count: 271,754
Atom	Atom Count	Percent	Variation %
Carbon	1,305,530	32.48	> ~0.2806
Hydrogen	1,449,705	36.07	> ~0.4782
Nitrogen	979,485	24.37	< ~1.0523
Oxygen	284,270	7.07	> ~0.2935
Totals	4,018,990	100.00	----

Promoter-Terminator Sections
Table: 5509 (Promoter Count: 71)
Link and genome info: NC_037335.1
Bos taurus isolate L1 Dominette 01449 registration number 42190680 breed Hereford chromosome 8
ARS-UCD2.0, whole genome shotgun sequence

Nucleotide count: 296,039
'N' Nucleotide Count: 150
Atom	Atom Count	Percent	Variation %
Carbon	1,422,940	32.45	> ~0.2440
Hydrogen	1,570,791	35.82	> ~0.2257
Nitrogen	1,093,897	24.94	< ~0.4795
Oxygen	297,740	6.79	> ~0.0097
Totals	4,385,368	100.00	----

Promoter-Terminator Sections
Table: 5510 (Promoter Count: 1)
Link and genome info: NKLS02001936.1
Bos taurus breed Hereford isolate L1 Dominette 01449 registration number 42190680 Leftover_ScbfJmS_720
whole genome shotgun sequence

Nucleotide count: 2,991
Atom	Atom Count	Percent	Variation %
Carbon	14,325	32.42	> ~0.2208
Hydrogen	15,719	35.58	< ~0.0138
Nitrogen	11,403	25.81	> ~0.3866
Oxygen	2,733	6.19	< ~0.5936
Totals	44,180	100.00	----

Promoter-Terminator Sections
Table: 5511 (Promoter Count: 62)
Link and genome info: NW_018394997.1
Danio rerio strain Tuebingen chromosome 17 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG17_1_25

Nucleotide count: 462,833
Atom	Atom Count	Percent	Variation %
Carbon	2,229,934	32.50	> ~0.3006
Hydrogen	2,458,788	35.84	> ~0.2466
Nitrogen	1,711,834	24.95	< ~0.4717
Oxygen	459,945	6.70	< ~0.0755
Totals	6,860,501	100.00	----

Promoter-Terminator Sections
Table: 5512 (Promoter Count: 13)
Link and genome info: NW_020191239.1
Bos taurus isolate L1 Dominette 01449 registration number 42190680 breed Hereford unplaced genomic scaffold
ARS-UCD2.0 Leftover_ScbfJmS_2158, whole genome shotgun sequence

Nucleotide count: 54,266
Atom	Atom Count	Percent	Variation %
Carbon	260,960	32.45	> ~0.2497
Hydrogen	288,609	35.89	> ~0.2984
Nitrogen	198,753	24.72	< ~0.7067
Oxygen	55,792	6.94	> ~0.1586
Totals	804,114	100.00	----

Promoter-Terminator Sections
Table: 5513 (Promoter Count: 12)
Link and genome info: KN538374.1
Homo sapiens chromosome 15 genomic contig HG2139_PATCH
GRC reference assembly FIX PATCH for GRCh38

Nucleotide count: 92,732
Atom	Atom Count	Percent	Variation %
Carbon	444,271	32.40	> ~0.1974
Hydrogen	488,819	35.65	> ~0.0565
Nitrogen	349,405	25.48	> ~0.0585
Oxygen	88,677	6.47	< ~0.3125
Totals	1,371,172	100.00	----

Promoter-Terminator Sections
Table: 5514 (Promoter Count: 1)
Link and genome info: NW_018395040.1
Danio rerio strain Tuebingen chromosome 18 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG18_1_40

Nucleotide count: 958
Atom	Atom Count	Percent	Variation %
Carbon	4,677	32.75	> ~0.5487
Hydrogen	5,119	35.85	> ~0.2541
Nitrogen	3,577	25.05	< ~0.3747
Oxygen	907	6.35	< ~0.4282
Totals	14,280	100.00	----

Promoter-Terminator Sections
Table: 5515 (Promoter Count: 1)
Link and genome info: NW_018394393.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA658

Nucleotide count: 2,877
'N' Nucleotide Count: 100
Atom	Atom Count	Percent	Variation %
Carbon	13,878	32.65	> ~0.4469
Hydrogen	15,493	36.45	> ~0.8566
Nitrogen	10,047	23.64	< ~1.7865
Oxygen	3,087	7.26	> ~0.4830
Totals	42,505	100.00	----

Promoter-Terminator Sections
Table: 5516 (Promoter Count: 11)
Link and genome info: NW_003337205.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA1051

Nucleotide count: 58,609
'N' Nucleotide Count: 800
Atom	Atom Count	Percent	Variation %
Carbon	282,087	32.52	> ~0.3126
Hydrogen	311,096	35.86	> ~0.2666
Nitrogen	216,976	25.01	< ~0.4130
Oxygen	57,374	6.61	< ~0.1662
Totals	867,533	100.00	----

Promoter-Terminator Sections
Table: 5517 (Promoter Count: 46)
Link and genome info: KZ115252.1
Danio rerio chromosome 7 genomic contig ALT_CTG7_1_45
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 241,228
Atom	Atom Count	Percent	Variation %
Carbon	1,163,594	32.55	> ~0.3421
Hydrogen	1,283,984	35.91	> ~0.3195
Nitrogen	887,516	24.82	< ~0.6001
Oxygen	240,194	6.72	< ~0.0615
Totals	3,575,288	100.00	----

Promoter-Terminator Sections
Table: 5518 (Promoter Count: 20)
Link and genome info: KZ114900.1
Danio rerio chromosome 8 genomic contig ALT_CTG8_2_6
GRCz11 reference assembly alternate locus group ALT_DRER_TU_2

Nucleotide count: 108,128
Atom	Atom Count	Percent	Variation %
Carbon	520,901	32.52	> ~0.3207
Hydrogen	574,805	35.89	> ~0.2966
Nitrogen	398,667	24.89	< ~0.5316
Oxygen	107,210	6.69	< ~0.0857
Totals	1,601,583	100.00	----

Promoter-Terminator Sections
Table: 5519 (Promoter Count: 56)
Link and genome info: KZ115568.1
Danio rerio chromosome 18 genomic contig ALT_CTG18_1_31
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 334,193
Atom	Atom Count	Percent	Variation %
Carbon	1,608,987	32.49	> ~0.2900
Hydrogen	1,776,023	35.87	> ~0.2735
Nitrogen	1,231,835	24.88	< ~0.5468
Oxygen	334,886	6.76	< ~0.0167
Totals	4,951,731	100.00	----

Promoter-Terminator Sections
Table: 5520 (Promoter Count: 40)
Link and genome info: NW_018395010.1
Danio rerio strain Tuebingen chromosome 18 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG18_1_10

Nucleotide count: 264,917
Atom	Atom Count	Percent	Variation %
Carbon	1,278,285	32.54	> ~0.3404
Hydrogen	1,410,823	35.92	> ~0.3249
Nitrogen	973,271	24.78	< ~0.6452
Oxygen	265,508	6.76	< ~0.0201
Totals	3,927,887	100.00	----

Promoter-Terminator Sections
Table: 5521 (Promoter Count: 245)
Link and genome info: CM002907.2
Danio rerio chromosome 23
GRCz11 reference primary assembly

Nucleotide count: 1,689,590
'N' Nucleotide Count: 7,203
Atom	Atom Count	Percent	Variation %
Carbon	8,116,018	32.45	> ~0.2472
Hydrogen	8,962,334	35.83	> ~0.2412
Nitrogen	6,240,934	24.95	< ~0.4703
Oxygen	1,691,109	6.76	< ~0.0181
Totals	25,010,395	100.00	----

Promoter-Terminator Sections
Table: 5522 (Promoter Count: 36)
Link and genome info: NW_018395258.1
Danio rerio strain Tuebingen chromosome 6 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_2 ALT_CTG6_2_11

Nucleotide count: 125,010
Atom	Atom Count	Percent	Variation %
Carbon	603,290	32.54	> ~0.3353
Hydrogen	666,155	35.93	> ~0.3361
Nitrogen	458,215	24.71	< ~0.7097
Oxygen	126,411	6.82	> ~0.0383
Totals	1,854,071	100.00	----

Promoter-Terminator Sections
Table: 5523 (Promoter Count: 89)
Link and genome info: GL949746.1
Homo sapiens chromosome 19 genomic contig
GRCh38 reference assembly alternate locus group ALT_REF_LOCI_1

Nucleotide count: 519,920
Atom	Atom Count	Percent	Variation %
Carbon	2,473,738	32.23	> ~0.0292
Hydrogen	2,732,527	35.60	> ~0.0114
Nitrogen	1,949,095	25.40	< ~0.0271
Oxygen	519,278	6.77	< ~0.0135
Totals	7,674,638	100.00	----

Promoter-Terminator Sections
Table: 5524 (Promoter Count: 19)
Link and genome info: KZ114990.1
Danio rerio chromosome 24 genomic contig ALT_CTG24_2_3
GRCz11 reference assembly alternate locus group ALT_DRER_TU_2

Nucleotide count: 114,704
Atom	Atom Count	Percent	Variation %
Carbon	553,769	32.56	> ~0.3606
Hydrogen	610,363	35.89	> ~0.2987
Nitrogen	423,489	24.90	< ~0.5207
Oxygen	112,936	6.64	< ~0.1386
Totals	1,700,557	100.00	----

Promoter-Terminator Sections
Table: 5525 (Promoter Count: 3)
Link and genome info: NW_020190519.1
Bos taurus isolate L1 Dominette 01449 registration number 42190680 breed Hereford unplaced genomic scaffold
ARS-UCD2.0 Leftover_ScbfJmS_1418, whole genome shotgun sequence

Nucleotide count: 6,310
Atom	Atom Count	Percent	Variation %
Carbon	30,351	32.50	> ~0.2968
Hydrogen	33,454	35.82	> ~0.2298
Nitrogen	23,440	25.10	< ~0.3238
Oxygen	6,142	6.58	< ~0.2028
Totals	93,387	100.00	----

Promoter-Terminator Sections
Table: 5526 (Promoter Count: 21)
Link and genome info: NT_167211.2
Homo sapiens unplaced genomic scaffold
GRCh38.p14 Primary Assembly HSCHRUN_RANDOM_CTG6

Nucleotide count: 85,360
Atom	Atom Count	Percent	Variation %
Carbon	404,553	32.41	> ~0.2057
Hydrogen	456,127	36.54	> ~0.9475
Nitrogen	294,325	23.58	< ~1.8451
Oxygen	93,266	7.47	> ~0.6919
Totals	1,248,271	100.00	----

Promoter-Terminator Sections
Table: 5527 (Promoter Count: 4)
Link and genome info: NC_006853.1
Bos taurus mitochondrion
complete genome

Nucleotide count: 6,565
Atom	Atom Count	Percent	Variation %
Carbon	31,241	32.44	> ~0.2369
Hydrogen	34,563	35.89	> ~0.2966
Nitrogen	24,443	25.38	< ~0.0424
Oxygen	6,056	6.29	< ~0.4912
Totals	96,303	100.00	----

Promoter-Terminator Sections
Table: 5528 (Promoter Count: 3)
Link and genome info: NKLS02001386.1
Bos taurus breed Hereford isolate L1 Dominette 01449 registration number 42190680 Leftover_ScbfJmS_2399
whole genome shotgun sequence

Nucleotide count: 3,756
Atom	Atom Count	Percent	Variation %
Carbon	18,016	32.31	> ~0.1019
Hydrogen	19,689	35.31	< ~0.2880
Nitrogen	14,525	26.05	> ~0.6217
Oxygen	3,538	6.34	< ~0.4356
Totals	55,768	100.00	----

Promoter-Terminator Sections
Table: 5529 (Promoter Count: 34)
Link and genome info: NW_018394940.1
Danio rerio strain Tuebingen chromosome 15 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG15_1_9

Nucleotide count: 218,017
Atom	Atom Count	Percent	Variation %
Carbon	1,051,801	32.54	> ~0.3362
Hydrogen	1,161,795	35.94	> ~0.3492
Nitrogen	798,387	24.70	< ~0.7240
Oxygen	220,394	6.82	> ~0.0386
Totals	3,232,377	100.00	----

Promoter-Terminator Sections
Table: 5530 (Promoter Count: 43)
Link and genome info: KZ115268.1
Danio rerio chromosome 8 genomic contig ALT_CTG8_1_16
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 293,559
Atom	Atom Count	Percent	Variation %
Carbon	1,416,511	32.54	> ~0.3413
Hydrogen	1,564,458	35.94	> ~0.3506
Nitrogen	1,075,238	24.70	< ~0.7199
Oxygen	296,305	6.81	> ~0.0280
Totals	4,352,512	100.00	----

Promoter-Terminator Sections
Table: 5531 (Promoter Count: 54)
Link and genome info: NW_018395179.1
Danio rerio strain Tuebingen chromosome 24 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG24_1_16

Nucleotide count: 278,356
Atom	Atom Count	Percent	Variation %
Carbon	1,341,023	32.53	> ~0.3261
Hydrogen	1,480,156	35.90	> ~0.3112
Nitrogen	1,025,138	24.87	< ~0.5567
Oxygen	276,172	6.70	< ~0.0805
Totals	4,122,489	100.00	----

Promoter-Terminator Sections
Table: 5532 (Promoter Count: 2)
Link and genome info: NW_020192102.1
Bos taurus isolate L1 Dominette 01449 registration number 42190680 breed Hereford unplaced genomic scaffold
ARS-UCD2.0 Leftover_ScbfJmS_805, whole genome shotgun sequence

Nucleotide count: 4,157
Atom	Atom Count	Percent	Variation %
Carbon	19,772	32.30	> ~0.0938
Hydrogen	21,860	35.71	> ~0.1147
Nitrogen	15,534	25.37	< ~0.0492
Oxygen	4,053	6.62	< ~0.1592
Totals	61,219	100.00	----

Promoter-Terminator Sections
Table: 5533 (Promoter Count: 38)
Link and genome info: NW_018395083.1
Danio rerio strain Tuebingen chromosome 21 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG21_1_6

Nucleotide count: 218,690
Atom	Atom Count	Percent	Variation %
Carbon	1,054,429	32.54	> ~0.3382
Hydrogen	1,161,247	35.84	> ~0.2450
Nitrogen	812,017	25.06	< ~0.3634
Oxygen	212,557	6.56	< ~0.2198
Totals	3,240,250	100.00	----

Promoter-Terminator Sections
Table: 5534 (Promoter Count: 4)
Link and genome info: CM000668.2
Homo sapiens chromosome 6
GRCh38 reference primary assembly

Nucleotide count: 2,728
Atom	Atom Count	Percent	Variation %
Carbon	13,141	32.53	> ~0.3230
Hydrogen	14,523	35.95	> ~0.3539
Nitrogen	9,993	24.73	< ~0.6892
Oxygen	2,744	6.79	> ~0.0122
Totals	40,401	100.00	----

Promoter-Terminator Sections
Table: 5535 (Promoter Count: 52)
Link and genome info: NW_018395230.1
Danio rerio strain Tuebingen chromosome 4 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_2 ALT_CTG4_2_1

Nucleotide count: 387,316
Atom	Atom Count	Percent	Variation %
Carbon	1,870,400	32.56	> ~0.3606
Hydrogen	2,062,499	35.91	> ~0.3153
Nitrogen	1,426,463	24.83	< ~0.5887
Oxygen	384,399	6.69	< ~0.0872
Totals	5,743,761	100.00	----

Promoter-Terminator Sections
Table: 5536 (Promoter Count: 11)
Link and genome info: KN150709.1
Danio rerio unplaced genomic contig NA1032
GRCz11 reference primary assembly

Nucleotide count: 49,625
'N' Nucleotide Count: 701
Atom	Atom Count	Percent	Variation %
Carbon	239,598	32.57	> ~0.3636
Hydrogen	264,770	35.99	> ~0.3952
Nitrogen	181,136	24.62	< ~0.8031
Oxygen	50,205	6.82	> ~0.0443
Totals	735,709	100.00	----

Promoter-Terminator Sections
Table: 5537 (Promoter Count: 38)
Link and genome info: KZ115620.1
Danio rerio chromosome 21 genomic contig ALT_CTG21_1_6
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 218,690
Atom	Atom Count	Percent	Variation %
Carbon	1,054,429	32.54	> ~0.3382
Hydrogen	1,161,247	35.84	> ~0.2450
Nitrogen	812,017	25.06	< ~0.3634
Oxygen	212,557	6.56	< ~0.2198
Totals	3,240,250	100.00	----

Promoter-Terminator Sections
Table: 5538 (Promoter Count: 45)
Link and genome info: NW_018395283.1
Danio rerio strain Tuebingen chromosome 9 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_2 ALT_CTG9_2_8

Nucleotide count: 222,076
Atom	Atom Count	Percent	Variation %
Carbon	1,070,697	32.54	> ~0.3346
Hydrogen	1,181,860	35.92	> ~0.3230
Nitrogen	816,574	24.82	< ~0.6084
Oxygen	221,472	6.73	< ~0.0493
Totals	3,290,603	100.00	----

Promoter-Terminator Sections
Table: 5539 (Promoter Count: 7)
Link and genome info: NW_003337200.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA405

Nucleotide count: 34,681
'N' Nucleotide Count: 100
Atom	Atom Count	Percent	Variation %
Carbon	167,011	32.48	> ~0.2737
Hydrogen	183,718	35.73	> ~0.1327
Nitrogen	129,678	25.22	< ~0.2064
Oxygen	33,836	6.58	< ~0.1999
Totals	514,243	100.00	----

Promoter-Terminator Sections
Table: 5540 (Promoter Count: 3)
Link and genome info: NW_020190772.1
Bos taurus isolate L1 Dominette 01449 registration number 42190680 breed Hereford unplaced genomic scaffold
ARS-UCD2.0 Leftover_ScbfJmS_1671, whole genome shotgun sequence

Nucleotide count: 9,796
Atom	Atom Count	Percent	Variation %
Carbon	47,108	32.49	> ~0.2867
Hydrogen	51,427	35.47	< ~0.1243
Nitrogen	37,895	26.14	> ~0.7122
Oxygen	8,562	5.91	< ~0.8745
Totals	144,992	100.00	----

Promoter-Terminator Sections
Table: 5541 (Promoter Count: 33)
Link and genome info: NT_113796.3
Homo sapiens chromosome 14 unlocalized genomic scaffold
GRCh38.p14 Primary Assembly HSCHR14_CTG1_UNLOCALIZED

Nucleotide count: 144,656
Atom	Atom Count	Percent	Variation %
Carbon	694,906	32.43	> ~0.2226
Hydrogen	766,846	35.78	> ~0.1897
Nitrogen	535,834	25.00	< ~0.4204
Oxygen	145,466	6.79	> ~0.0081
Totals	2,143,052	100.00	----

Promoter-Terminator Sections
Table: 5542 (Promoter Count: 9)
Link and genome info: KN150335.1
Danio rerio unplaced genomic contig NA68
GRCz11 reference primary assembly

Nucleotide count: 32,379
'N' Nucleotide Count: 300
Atom	Atom Count	Percent	Variation %
Carbon	155,965	32.54	> ~0.3394
Hydrogen	172,438	35.98	> ~0.3868
Nitrogen	118,406	24.71	< ~0.7177
Oxygen	32,452	6.77	< ~0.0084
Totals	479,261	100.00	----

Promoter-Terminator Sections
Table: 5543 (Promoter Count: 8)
Link and genome info: NKLS02000661.1
Bos taurus breed Hereford isolate L1 Dominette 01449 registration number 42190680 Leftover_ScbfJmS_1643
whole genome shotgun sequence

Nucleotide count: 16,774
Atom	Atom Count	Percent	Variation %
Carbon	80,213	32.39	> ~0.1861
Hydrogen	88,558	35.76	> ~0.1660
Nitrogen	62,492	25.23	< ~0.1898
Oxygen	16,388	6.62	< ~0.1623
Totals	247,651	100.00	----

Promoter-Terminator Sections
Table: 5544 (Promoter Count: 48)
Link and genome info: NW_018395173.1
Danio rerio strain Tuebingen chromosome 24 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG24_1_10

Nucleotide count: 277,326
Atom	Atom Count	Percent	Variation %
Carbon	1,337,139	32.53	> ~0.3290
Hydrogen	1,473,968	35.86	> ~0.2683
Nitrogen	1,025,634	24.95	< ~0.4702
Oxygen	273,432	6.65	< ~0.1271
Totals	4,110,173	100.00	----

Promoter-Terminator Sections
Table: 5545 (Promoter Count: 11)
Link and genome info: KI270895.1
Homo sapiens chromosome 3 genomic contig
GRCh38 reference assembly alternate locus group ALT_REF_LOCI_2

Nucleotide count: 82,253
Atom	Atom Count	Percent	Variation %
Carbon	390,653	32.23	> ~0.0243
Hydrogen	431,492	35.60	> ~0.0036
Nitrogen	309,360	25.52	> ~0.0976
Oxygen	80,660	6.65	< ~0.1255
Totals	1,212,165	100.00	----

Promoter-Terminator Sections
Table: 5546 (Promoter Count: 1)
Link and genome info: KZ115993.1
Danio rerio unplaced genomic contig NA999
GRCz11 reference primary assembly

Nucleotide count: 8,071
'N' Nucleotide Count: 300
Atom	Atom Count	Percent	Variation %
Carbon	39,174	32.64	> ~0.4326
Hydrogen	43,128	35.93	> ~0.3369
Nitrogen	29,674	24.72	< ~0.7022
Oxygen	8,057	6.71	< ~0.0674
Totals	120,033	100.00	----

Promoter-Terminator Sections
Table: 5547 (Promoter Count: 1)
Link and genome info: KN150042.1
Danio rerio unplaced genomic contig NA415
GRCz11 reference primary assembly

Nucleotide count: 743
Atom	Atom Count	Percent	Variation %
Carbon	3,585	32.58	> ~0.3786
Hydrogen	3,941	35.82	> ~0.2243
Nitrogen	2,777	25.24	< ~0.1851
Oxygen	700	6.36	< ~0.4178
Totals	11,003	100.00	----

Promoter-Terminator Sections
Table: 5548 (Promoter Count: 2)
Link and genome info: NW_008805367.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA185

Nucleotide count: 2,596
Atom	Atom Count	Percent	Variation %
Carbon	12,487	32.43	> ~0.2236
Hydrogen	13,793	35.82	> ~0.2253
Nitrogen	9,555	24.81	< ~0.6107
Oxygen	2,673	6.94	> ~0.1617
Totals	38,508	100.00	----

Promoter-Terminator Sections
Table: 5549 (Promoter Count: 1)
Link and genome info: KN150659.1
Danio rerio unplaced genomic contig NA990
GRCz11 reference primary assembly

Nucleotide count: 4,449
'N' Nucleotide Count: 100
Atom	Atom Count	Percent	Variation %
Carbon	21,448	32.47	> ~0.2626
Hydrogen	23,639	35.78	> ~0.1893
Nitrogen	16,469	24.93	< ~0.4945
Oxygen	4,507	6.82	> ~0.0426
Totals	66,063	100.00	----

Promoter-Terminator Sections
Table: 5550 (Promoter Count: 40)
Link and genome info: KZ115015.1
Danio rerio chromosome 1 genomic contig ALT_CTG1_1_19
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 240,856
Atom	Atom Count	Percent	Variation %
Carbon	1,161,502	32.55	> ~0.3494
Hydrogen	1,281,112	35.91	> ~0.3119
Nitrogen	888,228	24.89	< ~0.5298
Oxygen	237,209	6.65	< ~0.1316
Totals	3,568,051	100.00	----

Promoter-Terminator Sections
Table: 5551 (Promoter Count: 31)
Link and genome info: NW_025791792.1
Homo sapiens chromosome 11 genomic patch of type FIX
GRCh38.p14 PATCHES HG152_PATCH

Nucleotide count: 208,060
Atom	Atom Count	Percent	Variation %
Carbon	981,409	32.07	< ~0.1328
Hydrogen	1,085,161	35.46	< ~0.1321
Nitrogen	787,935	25.75	> ~0.3246
Oxygen	205,642	6.72	< ~0.0597
Totals	3,060,147	100.00	----

Promoter-Terminator Sections
Table: 5552 (Promoter Count: 28)
Link and genome info: NT_187504.1
Homo sapiens unplaced genomic scaffold
GRCh38.p14 Primary Assembly HSCHRUN_RANDOM_CTG26

Nucleotide count: 113,539
Atom	Atom Count	Percent	Variation %
Carbon	547,841	32.53	> ~0.3312
Hydrogen	602,269	35.77	> ~0.1737
Nitrogen	424,265	25.20	< ~0.2279
Oxygen	109,496	6.50	< ~0.2771
Totals	1,683,871	100.00	----

Promoter-Terminator Sections
Table: 5553 (Promoter Count: 3)
Link and genome info: KN150219.1
Danio rerio unplaced genomic contig NA579
GRCz11 reference primary assembly

Nucleotide count: 12,511
'N' Nucleotide Count: 300
Atom	Atom Count	Percent	Variation %
Carbon	60,532	32.50	> ~0.3010
Hydrogen	66,471	35.69	> ~0.1003
Nitrogen	46,761	25.11	< ~0.3140
Oxygen	12,463	6.69	< ~0.0873
Totals	186,227	100.00	----

Promoter-Terminator Sections
Table: 5554 (Promoter Count: 41)
Link and genome info: NW_018394911.1
Danio rerio strain Tuebingen chromosome 14 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG14_1_21

Nucleotide count: 214,696
Atom	Atom Count	Percent	Variation %
Carbon	1,035,791	32.53	> ~0.3224
Hydrogen	1,144,078	35.93	> ~0.3330
Nitrogen	786,308	24.69	< ~0.7321
Oxygen	218,345	6.86	> ~0.0767
Totals	3,184,522	100.00	----

Promoter-Terminator Sections
Table: 5555 (Promoter Count: 1)
Link and genome info: NW_003337069.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA184

Nucleotide count: 6,107
Atom	Atom Count	Percent	Variation %
Carbon	29,451	32.51	> ~0.3086
Hydrogen	32,438	35.81	> ~0.2163
Nitrogen	22,658	25.01	< ~0.4107
Oxygen	6,038	6.67	< ~0.1141
Totals	90,585	100.00	----

Promoter-Terminator Sections
Table: 5556 (Promoter Count: 2)
Link and genome info: NW_003337265.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA803

Nucleotide count: 3,813
Atom	Atom Count	Percent	Variation %
Carbon	18,387	32.45	> ~0.2458
Hydrogen	20,252	35.74	> ~0.1473
Nitrogen	14,148	24.97	< ~0.4555
Oxygen	3,877	6.84	> ~0.0624
Totals	56,664	100.00	----

Promoter-Terminator Sections
Table: 5557 (Promoter Count: 5)
Link and genome info: NW_003337197.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA49

Nucleotide count: 21,397
'N' Nucleotide Count: 100
Atom	Atom Count	Percent	Variation %
Carbon	103,124	32.54	> ~0.3328
Hydrogen	113,996	35.97	> ~0.3731
Nitrogen	78,230	24.68	< ~0.7417
Oxygen	21,602	6.82	> ~0.0358
Totals	316,952	100.00	----

Promoter-Terminator Sections
Table: 5558 (Promoter Count: 8)
Link and genome info: NW_003315960.1
Homo sapiens chromosome 18 genomic scaffold
GRCh38.p14 alternate locus group ALT_REF_LOCI_1 HSCHR18_2_CTG2

Nucleotide count: 33,878
Atom	Atom Count	Percent	Variation %
Carbon	163,220	32.50	> ~0.2929
Hydrogen	180,140	35.87	> ~0.2718
Nitrogen	124,800	24.85	< ~0.5766
Oxygen	34,112	6.79	> ~0.0118
Totals	502,272	100.00	----

Promoter-Terminator Sections
Table: 5559 (Promoter Count: 41)
Link and genome info: KZ115020.1
Danio rerio chromosome 1 genomic contig ALT_CTG1_1_24
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 185,474
Atom	Atom Count	Percent	Variation %
Carbon	892,530	32.48	> ~0.2763
Hydrogen	984,654	35.83	> ~0.2390
Nitrogen	685,838	24.96	< ~0.4656
Oxygen	184,939	6.73	< ~0.0497
Totals	2,747,961	100.00	----

Promoter-Terminator Sections
Table: 5560 (Promoter Count: 4)
Link and genome info: KN150120.1
Danio rerio unplaced genomic contig NA483
GRCz11 reference primary assembly

Nucleotide count: 13,928
Atom	Atom Count	Percent	Variation %
Carbon	67,083	32.48	> ~0.2787
Hydrogen	73,854	35.76	> ~0.1675
Nitrogen	51,884	25.12	< ~0.3011
Oxygen	13,702	6.63	< ~0.1451
Totals	206,523	100.00	----

Promoter-Terminator Sections
Table: 5561 (Promoter Count: 38)
Link and genome info: NW_018394876.1
Danio rerio strain Tuebingen chromosome 13 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG13_1_17

Nucleotide count: 256,728
Atom	Atom Count	Percent	Variation %
Carbon	1,237,212	32.51	> ~0.3064
Hydrogen	1,365,645	35.88	> ~0.2914
Nitrogen	944,769	24.83	< ~0.5983
Oxygen	258,030	6.78	> ~0.0005
Totals	3,805,656	100.00	----

Promoter-Terminator Sections
Table: 5562 (Promoter Count: 50)
Link and genome info: KZ115759.1
Danio rerio chromosome 11 genomic contig ALT_CTG11_3_2
GRCz11 reference assembly alternate locus group ALT_DRER_TU_3

Nucleotide count: 300,046
Atom	Atom Count	Percent	Variation %
Carbon	1,446,221	32.53	> ~0.3227
Hydrogen	1,598,699	35.96	> ~0.3622
Nitrogen	1,096,805	24.67	< ~0.7561
Oxygen	304,611	6.85	> ~0.0711
Totals	4,446,336	100.00	----

Promoter-Terminator Sections
Table: 5563 (Promoter Count: 25)
Link and genome info: NW_018394561.1
Danio rerio strain Tuebingen chromosome 4 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG4_1_15

Nucleotide count: 120,215
Atom	Atom Count	Percent	Variation %
Carbon	577,345	32.44	> ~0.2371
Hydrogen	637,444	35.82	> ~0.2242
Nitrogen	444,508	24.98	< ~0.4472
Oxygen	120,407	6.77	< ~0.0141
Totals	1,779,704	100.00	----

Promoter-Terminator Sections
Table: 5564 (Promoter Count: 65)
Link and genome info: KZ115030.1
Danio rerio chromosome 1 genomic contig ALT_CTG1_1_34
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 402,600
Atom	Atom Count	Percent	Variation %
Carbon	1,941,124	32.53	> ~0.3298
Hydrogen	2,141,524	35.89	> ~0.2987
Nitrogen	1,483,676	24.87	< ~0.5573
Oxygen	400,277	6.71	< ~0.0711
Totals	5,966,601	100.00	----

Promoter-Terminator Sections
Table: 5565 (Promoter Count: 1)
Link and genome info: NW_008805397.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA284

Nucleotide count: 3,608
Atom	Atom Count	Percent	Variation %
Carbon	17,479	32.46	> ~0.2613
Hydrogen	19,132	35.53	< ~0.0583
Nitrogen	13,642	25.34	< ~0.0857
Oxygen	3,587	6.66	< ~0.1174
Totals	53,840	100.00	----

Promoter-Terminator Sections
Table: 5566 (Promoter Count: 60)
Link and genome info: NW_020192290.1
Bos taurus isolate L1 Dominette 01449 registration number 42190680 breed Hereford unplaced genomic scaffold
ARS-UCD2.0 ScbfJmS_848_142, whole genome shotgun sequence

Nucleotide count: 246,362
'N' Nucleotide Count: 25
Atom	Atom Count	Percent	Variation %
Carbon	1,177,656	32.35	> ~0.1441
Hydrogen	1,299,014	35.68	> ~0.0878
Nitrogen	921,890	25.32	< ~0.1015
Oxygen	242,077	6.65	< ~0.1304
Totals	3,640,637	100.00	----

Promoter-Terminator Sections
Table: 5567 (Promoter Count: 31)
Link and genome info: NW_018394620.1
Danio rerio strain Tuebingen chromosome 5 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG5_1_59

Nucleotide count: 185,631
Atom	Atom Count	Percent	Variation %
Carbon	894,868	32.52	> ~0.3194
Hydrogen	988,469	35.92	> ~0.3314
Nitrogen	680,639	24.74	< ~0.6868
Oxygen	187,537	6.82	> ~0.0361
Totals	2,751,513	100.00	----

Promoter-Terminator Sections
Table: 5568 (Promoter Count: 1)
Link and genome info: NT_187381.1
Homo sapiens chromosome 14 unlocalized genomic scaffold
GRCh38.p14 Primary Assembly HSCHR14_CTG8_UNLOCALIZED

Nucleotide count: 3,040
Atom	Atom Count	Percent	Variation %
Carbon	14,562	32.39	> ~0.1832
Hydrogen	16,051	35.70	> ~0.1050
Nitrogen	11,371	25.29	< ~0.1340
Oxygen	2,979	6.63	< ~0.1543
Totals	44,963	100.00	----

Promoter-Terminator Sections
Table: 5569 (Promoter Count: 1)
Link and genome info: NW_020191568.1
Bos taurus isolate L1 Dominette 01449 registration number 42190680 breed Hereford unplaced genomic scaffold
ARS-UCD2.0 Leftover_ScbfJmS_254, whole genome shotgun sequence

Nucleotide count: 1,687
Atom	Atom Count	Percent	Variation %
Carbon	7,978	32.39	> ~0.1827
Hydrogen	8,720	35.40	< ~0.1950
Nitrogen	6,666	27.06	> ~1.6365
Oxygen	1,270	5.16	< ~1.6242
Totals	24,634	100.00	----

Promoter-Terminator Sections
Table: 5570 (Promoter Count: 38)
Link and genome info: NW_018394627.1
Danio rerio strain Tuebingen chromosome 6 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG6_1_5

Nucleotide count: 243,804
Atom	Atom Count	Percent	Variation %
Carbon	1,174,180	32.51	> ~0.3064
Hydrogen	1,296,300	35.89	> ~0.2977
Nitrogen	897,500	24.85	< ~0.5744
Oxygen	243,797	6.75	< ~0.0296
Totals	3,611,777	100.00	----

Promoter-Terminator Sections
Table: 5571 (Promoter Count: 4)
Link and genome info: NW_018394867.1
Danio rerio strain Tuebingen chromosome 13 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG13_1_8

Nucleotide count: 26,309
Atom	Atom Count	Percent	Variation %
Carbon	126,959	32.54	> ~0.3377
Hydrogen	140,551	36.02	> ~0.4317
Nitrogen	95,355	24.44	< ~0.9831
Oxygen	27,285	6.99	> ~0.2138
Totals	390,150	100.00	----

Promoter-Terminator Sections
Table: 5572 (Promoter Count: 38)
Link and genome info: NW_018395285.1
Danio rerio strain Tuebingen chromosome 9 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_2 ALT_CTG9_2_10

Nucleotide count: 287,100
Atom	Atom Count	Percent	Variation %
Carbon	1,384,022	32.53	> ~0.3301
Hydrogen	1,526,124	35.87	> ~0.2807
Nitrogen	1,060,672	24.93	< ~0.4910
Oxygen	283,320	6.66	< ~0.1198
Totals	4,254,138	100.00	----

Promoter-Terminator Sections
Table: 5573 (Promoter Count: 19)
Link and genome info: KZ208909.1
Homo sapiens chromosome 3 genomic contig HSCHR3_4_CTG1
GRC reference assembly NOVEL PATCH for GRCh38

Nucleotide count: 63,138
Atom	Atom Count	Percent	Variation %
Carbon	304,436	32.54	> ~0.3334
Hydrogen	336,273	35.94	> ~0.3462
Nitrogen	231,433	24.73	< ~0.6891
Oxygen	63,524	6.79	> ~0.0095
Totals	935,666	100.00	----

Promoter-Terminator Sections
Table: 5574 (Promoter Count: 34)
Link and genome info: NW_018394942.1
Danio rerio strain Tuebingen chromosome 15 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG15_1_11

Nucleotide count: 234,469
Atom	Atom Count	Percent	Variation %
Carbon	1,129,740	32.52	> ~0.3203
Hydrogen	1,246,099	35.87	> ~0.2803
Nitrogen	865,873	24.93	< ~0.4964
Oxygen	231,877	6.68	< ~0.1043
Totals	3,473,589	100.00	----

Promoter-Terminator Sections
Table: 5575 (Promoter Count: 2)
Link and genome info: NW_003334033.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA67

Nucleotide count: 3,702
'N' Nucleotide Count: 200
Atom	Atom Count	Percent	Variation %
Carbon	18,005	32.72	> ~0.5139
Hydrogen	19,887	36.14	> ~0.5440
Nitrogen	13,369	24.29	< ~1.1306
Oxygen	3,771	6.85	> ~0.0727
Totals	55,032	100.00	----

Promoter-Terminator Sections
Table: 5576 (Promoter Count: 3)
Link and genome info: NW_003336929.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA722

Nucleotide count: 5,185
Atom	Atom Count	Percent	Variation %
Carbon	25,098	32.63	> ~0.4249
Hydrogen	27,761	36.09	> ~0.4971
Nitrogen	18,763	24.39	< ~1.0311
Oxygen	5,299	6.89	> ~0.1092
Totals	76,921	100.00	----

Promoter-Terminator Sections
Table: 5577 (Promoter Count: 2)
Link and genome info: NW_003336315.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA248

Nucleotide count: 6,792
'N' Nucleotide Count: 200
Atom	Atom Count	Percent	Variation %
Carbon	32,637	32.47	> ~0.2696
Hydrogen	36,089	35.91	> ~0.3145
Nitrogen	24,927	24.80	< ~0.6219
Oxygen	6,852	6.82	> ~0.0379
Totals	100,505	100.00	----

Promoter-Terminator Sections
Table: 5578 (Promoter Count: 1)
Link and genome info: NKLS02000436.1
Bos taurus breed Hereford isolate L1 Dominette 01449 registration number 42190680 Leftover_ScbfJmS_1419
whole genome shotgun sequence

Nucleotide count: 2,119
Atom	Atom Count	Percent	Variation %
Carbon	10,161	32.35	> ~0.1482
Hydrogen	11,193	35.64	> ~0.0442
Nitrogen	7,933	25.26	< ~0.1658
Oxygen	2,121	6.75	< ~0.0266
Totals	31,408	100.00	----

Promoter-Terminator Sections
Table: 5579 (Promoter Count: 17)
Link and genome info: NT_187666.1
Homo sapiens chromosome 18 genomic scaffold
GRCh38.p14 alternate locus group ALT_REF_LOCI_2 HSCHR18_ALT2_CTG2_1

Nucleotide count: 103,535
Atom	Atom Count	Percent	Variation %
Carbon	492,052	32.27	> ~0.0654
Hydrogen	544,804	35.73	> ~0.1351
Nitrogen	385,042	25.25	< ~0.1726
Oxygen	102,954	6.75	< ~0.0280
Totals	1,524,852	100.00	----

Promoter-Terminator Sections
Table: 5580 (Promoter Count: 29)
Link and genome info: NW_018395014.1
Danio rerio strain Tuebingen chromosome 18 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG18_1_14

Nucleotide count: 148,919
Atom	Atom Count	Percent	Variation %
Carbon	718,803	32.54	> ~0.3397
Hydrogen	795,146	36.00	> ~0.4063
Nitrogen	541,358	24.51	< ~0.9142
Oxygen	153,465	6.95	> ~0.1683
Totals	2,208,772	100.00	----

Promoter-Terminator Sections
Table: 5581 (Promoter Count: 86)
Link and genome info: GL877876.1
Homo sapiens chromosome 12 genomic contig
GRCh38 reference assembly alternate locus group ALT_REF_LOCI_1

Nucleotide count: 305,725
Atom	Atom Count	Percent	Variation %
Carbon	1,472,052	32.52	> ~0.3148
Hydrogen	1,621,977	35.83	> ~0.2369
Nitrogen	1,135,423	25.08	< ~0.3418
Oxygen	297,405	6.57	< ~0.2099
Totals	4,526,857	100.00	----

Promoter-Terminator Sections
Table: 5582 (Promoter Count: 26)
Link and genome info: KN196479.1
Homo sapiens chromosome 9 genomic contig HG2030_PATCH
GRC reference assembly FIX PATCH for GRCh38

Nucleotide count: 181,818
Atom	Atom Count	Percent	Variation %
Carbon	862,800	32.17	< ~0.0297
Hydrogen	951,869	35.50	< ~0.0981
Nitrogen	688,173	25.66	> ~0.2382
Oxygen	178,850	6.67	< ~0.1104
Totals	2,681,692	100.00	----

Promoter-Terminator Sections
Table: 5583 (Promoter Count: 12)
Link and genome info: NW_008805458.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA559

Nucleotide count: 58,459
'N' Nucleotide Count: 400
Atom	Atom Count	Percent	Variation %
Carbon	282,503	32.55	> ~0.3469
Hydrogen	311,681	35.91	> ~0.3190
Nitrogen	214,553	24.72	< ~0.7027
Oxygen	59,160	6.82	> ~0.0368
Totals	867,897	100.00	----

Promoter-Terminator Sections
Table: 5584 (Promoter Count: 26)
Link and genome info: KZ115230.1
Danio rerio chromosome 7 genomic contig ALT_CTG7_1_23
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 180,730
Atom	Atom Count	Percent	Variation %
Carbon	869,631	32.50	> ~0.2998
Hydrogen	960,293	35.89	> ~0.2986
Nitrogen	665,683	24.88	< ~0.5432
Oxygen	179,914	6.72	< ~0.0553
Totals	2,675,521	100.00	----

Promoter-Terminator Sections
Table: 5585 (Promoter Count: 4)
Link and genome info: NW_020190791.1
Bos taurus isolate L1 Dominette 01449 registration number 42190680 breed Hereford unplaced genomic scaffold
ARS-UCD2.0 Leftover_ScbfJmS_169, whole genome shotgun sequence

Nucleotide count: 11,108
Atom	Atom Count	Percent	Variation %
Carbon	53,252	32.26	> ~0.0576
Hydrogen	58,577	35.49	< ~0.1062
Nitrogen	41,853	25.36	< ~0.0684
Oxygen	11,384	6.90	> ~0.1169
Totals	165,066	100.00	----

Promoter-Terminator Sections
Table: 5586 (Promoter Count: 8)
Link and genome info: KN149787.1
Danio rerio unplaced genomic contig NA179
GRCz11 reference primary assembly

Nucleotide count: 26,750
'N' Nucleotide Count: 100
Atom	Atom Count	Percent	Variation %
Carbon	128,691	32.50	> ~0.2965
Hydrogen	142,061	35.88	> ~0.2832
Nitrogen	98,699	24.93	< ~0.4980
Oxygen	26,522	6.70	< ~0.0818
Totals	395,973	100.00	----

Promoter-Terminator Sections
Table: 5587 (Promoter Count: 1)
Link and genome info: KI270587.1
Homo sapiens unplaced genomic contig
GRCh38 reference primary assembly

Nucleotide count: 1,323
Atom	Atom Count	Percent	Variation %
Carbon	6,363	32.53	> ~0.3223
Hydrogen	7,021	35.89	> ~0.2960
Nitrogen	4,893	25.01	< ~0.4122
Oxygen	1,286	6.57	< ~0.2061
Totals	19,563	100.00	----

Promoter-Terminator Sections
Table: 5588 (Promoter Count: 37)
Link and genome info: ML143376.1
Homo sapiens chromosome 19 genomic contig HG109_PATCH
GRC reference assembly FIX PATCH for GRCh38

Nucleotide count: 256,551
Atom	Atom Count	Percent	Variation %
Carbon	1,215,910	32.14	< ~0.0620
Hydrogen	1,342,860	35.50	< ~0.0959
Nitrogen	968,750	25.61	> ~0.1843
Oxygen	255,477	6.75	< ~0.0264
Totals	3,782,997	100.00	----

Promoter-Terminator Sections
Table: 5589 (Promoter Count: 13)
Link and genome info: ML143359.1
Homo sapiens chromosome 11 genomic contig HG2115_PATCH
GRC reference assembly FIX PATCH for GRCh38

Nucleotide count: 132,064
Atom	Atom Count	Percent	Variation %
Carbon	630,025	32.26	> ~0.0582
Hydrogen	697,198	35.70	> ~0.1081
Nitrogen	489,096	25.05	< ~0.3787
Oxygen	136,547	6.99	> ~0.2124
Totals	1,952,866	100.00	----

Promoter-Terminator Sections
Table: 5590 (Promoter Count: 1)
Link and genome info: NW_020192201.1
Bos taurus isolate L1 Dominette 01449 registration number 42190680 breed Hereford unplaced genomic scaffold
ARS-UCD2.0 Leftover_ScbfJmS_914, whole genome shotgun sequence

Nucleotide count: 3,992
Atom	Atom Count	Percent	Variation %
Carbon	19,293	32.54	> ~0.3394
Hydrogen	21,065	35.53	< ~0.0614
Nitrogen	15,311	25.83	> ~0.4024
Oxygen	3,616	6.10	< ~0.6803
Totals	59,285	100.00	----

Promoter-Terminator Sections
Table: 5591 (Promoter Count: 48)
Link and genome info: KZ115682.1
Danio rerio chromosome 23 genomic contig ALT_CTG23_1_19
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 321,984
Atom	Atom Count	Percent	Variation %
Carbon	1,551,485	32.52	> ~0.3170
Hydrogen	1,711,959	35.88	> ~0.2909
Nitrogen	1,186,933	24.88	< ~0.5446
Oxygen	320,423	6.72	< ~0.0634
Totals	4,770,800	100.00	----

Promoter-Terminator Sections
Table: 5592 (Promoter Count: 63)
Link and genome info: KZ115139.1
Danio rerio chromosome 5 genomic contig ALT_CTG5_1_41
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 355,038
Atom	Atom Count	Percent	Variation %
Carbon	1,710,821	32.52	> ~0.3153
Hydrogen	1,888,283	35.89	> ~0.2987
Nitrogen	1,307,173	24.85	< ~0.5774
Oxygen	354,757	6.74	< ~0.0366
Totals	5,261,034	100.00	----

Promoter-Terminator Sections
Table: 5593 (Promoter Count: 1)
Link and genome info: KZ116001.1
Danio rerio unplaced genomic contig NA658
GRCz11 reference primary assembly

Nucleotide count: 2,877
'N' Nucleotide Count: 100
Atom	Atom Count	Percent	Variation %
Carbon	13,878	32.65	> ~0.4469
Hydrogen	15,493	36.45	> ~0.8566
Nitrogen	10,047	23.64	< ~1.7865
Oxygen	3,087	7.26	> ~0.4830
Totals	42,505	100.00	----

Promoter-Terminator Sections
Table: 5594 (Promoter Count: 57)
Link and genome info: KZ115292.1
Danio rerio chromosome 9 genomic contig ALT_CTG9_1_13
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 302,875
Atom	Atom Count	Percent	Variation %
Carbon	1,460,654	32.53	> ~0.3277
Hydrogen	1,612,944	35.92	> ~0.3296
Nitrogen	1,111,226	24.75	< ~0.6749
Oxygen	305,201	6.80	> ~0.0176
Totals	4,490,025	100.00	----

Promoter-Terminator Sections
Table: 5595 (Promoter Count: 3)
Link and genome info: NKLS02001765.1
Bos taurus breed Hereford isolate L1 Dominette 01449 registration number 42190680 Leftover_ScbfJmS_548
whole genome shotgun sequence

Nucleotide count: 10,720
Atom	Atom Count	Percent	Variation %
Carbon	51,353	32.38	> ~0.1808
Hydrogen	56,394	35.56	< ~0.0300
Nitrogen	40,724	25.68	> ~0.2577
Oxygen	10,103	6.37	< ~0.4085
Totals	158,574	100.00	----

Promoter-Terminator Sections
Table: 5596 (Promoter Count: 38)
Link and genome info: NW_018394913.1
Danio rerio strain Tuebingen chromosome 14 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG14_1_23

Nucleotide count: 255,439
Atom	Atom Count	Percent	Variation %
Carbon	1,232,892	32.53	> ~0.3298
Hydrogen	1,359,478	35.87	> ~0.2803
Nitrogen	941,740	24.85	< ~0.5734
Oxygen	255,538	6.74	< ~0.0366
Totals	3,789,648	100.00	----

Promoter-Terminator Sections
Table: 5597 (Promoter Count: 37)
Link and genome info: NW_018395255.1
Danio rerio strain Tuebingen chromosome 6 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_2 ALT_CTG6_2_8

Nucleotide count: 201,460
Atom	Atom Count	Percent	Variation %
Carbon	972,585	32.54	> ~0.3409
Hydrogen	1,073,535	35.92	> ~0.3291
Nitrogen	739,165	24.73	< ~0.6900
Oxygen	203,210	6.80	> ~0.0200
Totals	2,988,495	100.00	----

Promoter-Terminator Sections
Table: 5598 (Promoter Count: 67)
Link and genome info: KZ115401.1
Danio rerio chromosome 13 genomic contig ALT_CTG13_1_5
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 348,662
Atom	Atom Count	Percent	Variation %
Carbon	1,678,766	32.51	> ~0.3046
Hydrogen	1,853,228	35.89	> ~0.2932
Nitrogen	1,284,468	24.87	< ~0.5509
Oxygen	347,693	6.73	< ~0.0469
Totals	5,164,155	100.00	----

Promoter-Terminator Sections
Table: 5599 (Promoter Count: 3)
Link and genome info: KN149924.1
Danio rerio unplaced genomic contig NA29
GRCz11 reference primary assembly

Nucleotide count: 16,795
Atom	Atom Count	Percent	Variation %
Carbon	80,899	32.45	> ~0.2481
Hydrogen	88,882	35.65	> ~0.0606
Nitrogen	63,102	25.31	< ~0.1112
Oxygen	16,409	6.58	< ~0.1975
Totals	249,292	100.00	----

Promoter-Terminator Sections
Table: 5600 (Promoter Count: 7)
Link and genome info: KV880764.1
Homo sapiens chromosome 7 genomic contig HG2088_PATCH
GRC reference assembly FIX PATCH for GRCh38

Nucleotide count: 61,154
Atom	Atom Count	Percent	Variation %
Carbon	292,849	32.40	> ~0.1927
Hydrogen	322,464	35.67	> ~0.0791
Nitrogen	229,846	25.43	> ~0.0028
Oxygen	58,804	6.51	< ~0.2746
Totals	903,963	100.00	----

Promoter-Terminator Sections
Table: 5601 (Promoter Count: 6)
Link and genome info: NW_003336407.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA997

Nucleotide count: 47,238
'N' Nucleotide Count: 200
Atom	Atom Count	Percent	Variation %
Carbon	227,509	32.46	> ~0.2603
Hydrogen	251,071	35.83	> ~0.2326
Nitrogen	174,185	24.85	< ~0.5689
Oxygen	48,046	6.86	> ~0.0761
Totals	700,811	100.00	----

Promoter-Terminator Sections
Table: 5602 (Promoter Count: 17)
Link and genome info: NT_167218.1
Homo sapiens unplaced genomic scaffold
GRCh38.p14 Primary Assembly HSCHRUN_RANDOM_CTG16

Nucleotide count: 96,095
Atom	Atom Count	Percent	Variation %
Carbon	460,663	32.35	> ~0.1497
Hydrogen	508,001	35.68	> ~0.0846
Nitrogen	358,273	25.16	< ~0.2616
Oxygen	96,922	6.81	> ~0.0273
Totals	1,423,859	100.00	----

Promoter-Terminator Sections
Table: 5603 (Promoter Count: 35)
Link and genome info: KZ115308.1
Danio rerio chromosome 10 genomic contig ALT_CTG10_1_9
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 227,616
Atom	Atom Count	Percent	Variation %
Carbon	1,097,432	32.52	> ~0.3209
Hydrogen	1,208,477	35.82	> ~0.2221
Nitrogen	845,593	25.06	< ~0.3631
Oxygen	222,687	6.60	< ~0.1800
Totals	3,374,189	100.00	----

Promoter-Terminator Sections
Table: 5604 (Promoter Count: 25)
Link and genome info: NW_008805506.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA726

Nucleotide count: 62,468
'N' Nucleotide Count: 600
Atom	Atom Count	Percent	Variation %
Carbon	300,151	32.46	> ~0.2522
Hydrogen	331,408	35.84	> ~0.2423
Nitrogen	230,758	24.95	< ~0.4716
Oxygen	62,487	6.76	< ~0.0229
Totals	924,804	100.00	----

Promoter-Terminator Sections
Table: 5605 (Promoter Count: 17)
Link and genome info: NT_187657.1
Homo sapiens chromosome 11 genomic scaffold
GRCh38.p14 alternate locus group ALT_REF_LOCI_2 HSCHR11_2_CTG1_1

Nucleotide count: 107,596
Atom	Atom Count	Percent	Variation %
Carbon	508,486	32.13	< ~0.0770
Hydrogen	562,910	35.56	< ~0.0282
Nitrogen	404,202	25.54	> ~0.1140
Oxygen	107,167	6.77	< ~0.0088
Totals	1,582,765	100.00	----

Promoter-Terminator Sections
Table: 5606 (Promoter Count: 6)
Link and genome info: KZ208921.1
Homo sapiens chromosome 16 genomic contig HSCHR16_5_CTG3_1
GRC reference assembly NOVEL PATCH for GRCh38

Nucleotide count: 61,900
Atom	Atom Count	Percent	Variation %
Carbon	293,401	32.17	< ~0.0320
Hydrogen	323,052	35.42	< ~0.1706
Nitrogen	236,646	25.95	> ~0.5245
Oxygen	58,895	6.46	< ~0.3219
Totals	911,994	100.00	----

Promoter-Terminator Sections
Table: 5607 (Promoter Count: 77)
Link and genome info: KZ208920.1
Homo sapiens chromosome 14 genomic contig HG1_PATCH
GRC reference assembly FIX PATCH for GRCh38

Nucleotide count: 249,341
Atom	Atom Count	Percent	Variation %
Carbon	1,193,165	32.38	> ~0.1730
Hydrogen	1,315,889	35.71	> ~0.1133
Nitrogen	932,073	25.29	< ~0.1320
Oxygen	244,163	6.63	< ~0.1544
Totals	3,685,290	100.00	----

Promoter-Terminator Sections
Table: 5608 (Promoter Count: 4)
Link and genome info: NW_020190418.1
Bos taurus isolate L1 Dominette 01449 registration number 42190680 breed Hereford unplaced genomic scaffold
ARS-UCD2.0 Leftover_ScbfJmS_1312, whole genome shotgun sequence

Nucleotide count: 5,046
Atom	Atom Count	Percent	Variation %
Carbon	24,169	32.45	> ~0.2500
Hydrogen	26,919	36.15	> ~0.5528
Nitrogen	18,041	24.22	< ~1.1988
Oxygen	5,344	7.18	> ~0.3961
Totals	74,473	100.00	----

Promoter-Terminator Sections
Table: 5609 (Promoter Count: 4)
Link and genome info: NKLS02001229.1
Bos taurus breed Hereford isolate L1 Dominette 01449 registration number 42190680 Leftover_ScbfJmS_2231
whole genome shotgun sequence

Nucleotide count: 7,177
Atom	Atom Count	Percent	Variation %
Carbon	34,309	32.32	> ~0.1212
Hydrogen	37,810	35.62	> ~0.0299
Nitrogen	26,958	25.40	< ~0.0249
Oxygen	7,062	6.65	< ~0.1262
Totals	106,139	100.00	----

Promoter-Terminator Sections
Table: 5610 (Promoter Count: 55)
Link and genome info: NW_018395144.1
Danio rerio strain Tuebingen chromosome 23 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG23_1_18

Nucleotide count: 379,212
Atom	Atom Count	Percent	Variation %
Carbon	1,830,026	32.54	> ~0.3401
Hydrogen	2,021,237	35.94	> ~0.3506
Nitrogen	1,388,461	24.69	< ~0.7326
Oxygen	383,598	6.82	> ~0.0419
Totals	5,623,322	100.00	----

Promoter-Terminator Sections
Table: 5611 (Promoter Count: 21)
Link and genome info: KZ114897.1
Danio rerio chromosome 8 genomic contig ALT_CTG8_2_3
GRCz11 reference assembly alternate locus group ALT_DRER_TU_2

Nucleotide count: 148,545
Atom	Atom Count	Percent	Variation %
Carbon	716,890	32.53	> ~0.3273
Hydrogen	790,640	35.88	> ~0.2841
Nitrogen	547,310	24.84	< ~0.5881
Oxygen	148,894	6.76	< ~0.0233
Totals	2,203,734	100.00	----

Promoter-Terminator Sections
Table: 5612 (Promoter Count: 101)
Link and genome info: NW_025791753.1
Homo sapiens chromosome 1 genomic patch of type NOVEL
GRCh38.p14 PATCHES HSCHR1_12_CTG3

Nucleotide count: 299,929
Atom	Atom Count	Percent	Variation %
Carbon	1,439,440	32.42	> ~0.2164
Hydrogen	1,586,254	35.73	> ~0.1332
Nitrogen	1,119,408	25.21	< ~0.2118
Oxygen	294,901	6.64	< ~0.1378
Totals	4,440,003	100.00	----

Promoter-Terminator Sections
Table: 5613 (Promoter Count: 2)
Link and genome info: NW_020190861.1
Bos taurus isolate L1 Dominette 01449 registration number 42190680 breed Hereford unplaced genomic scaffold
ARS-UCD2.0 Leftover_ScbfJmS_1760, whole genome shotgun sequence

Nucleotide count: 21,784
Atom	Atom Count	Percent	Variation %
Carbon	103,419	32.24	> ~0.0399
Hydrogen	114,438	35.68	> ~0.0855
Nitrogen	81,364	25.37	< ~0.0566
Oxygen	21,525	6.71	< ~0.0688
Totals	320,746	100.00	----

Promoter-Terminator Sections
Table: 5614 (Promoter Count: 18)
Link and genome info: NW_025791809.1
Homo sapiens chromosome 19 genomic patch of type FIX
GRCh38.p14 PATCHES HG2469_PATCH

Nucleotide count: 94,097
Atom	Atom Count	Percent	Variation %
Carbon	450,498	32.27	> ~0.0648
Hydrogen	497,152	35.61	> ~0.0167
Nitrogen	350,510	25.11	< ~0.3174
Oxygen	97,946	7.02	> ~0.2360
Totals	1,396,106	100.00	----

Promoter-Terminator Sections
Table: 5615 (Promoter Count: 70)
Link and genome info: NW_018394743.1
Danio rerio strain Tuebingen chromosome 9 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG9_1_1

Nucleotide count: 414,005
Atom	Atom Count	Percent	Variation %
Carbon	1,994,366	32.51	> ~0.3052
Hydrogen	2,204,129	35.93	> ~0.3346
Nitrogen	1,516,395	24.72	< ~0.7061
Oxygen	419,997	6.85	> ~0.0663
Totals	6,134,887	100.00	----

Promoter-Terminator Sections
Table: 5616 (Promoter Count: 23)
Link and genome info: NW_018395104.1
Danio rerio strain Tuebingen chromosome 22 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG22_1_7

Nucleotide count: 160,981
Atom	Atom Count	Percent	Variation %
Carbon	776,256	32.52	> ~0.3163
Hydrogen	857,711	35.93	> ~0.3389
Nitrogen	589,189	24.68	< ~0.7408
Oxygen	163,878	6.87	> ~0.0856
Totals	2,387,034	100.00	----

Promoter-Terminator Sections
Table: 5617 (Promoter Count: 1)
Link and genome info: NW_020190915.1
Bos taurus isolate L1 Dominette 01449 registration number 42190680 breed Hereford unplaced genomic scaffold
ARS-UCD2.0 Leftover_ScbfJmS_1816, whole genome shotgun sequence

Nucleotide count: 12,355
Atom	Atom Count	Percent	Variation %
Carbon	59,056	32.30	> ~0.1006
Hydrogen	65,181	35.65	> ~0.0613
Nitrogen	46,119	25.23	< ~0.1963
Oxygen	12,457	6.81	> ~0.0344
Totals	182,813	100.00	----

Promoter-Terminator Sections
Table: 5618 (Promoter Count: 54)
Link and genome info: KZ115247.1
Danio rerio chromosome 7 genomic contig ALT_CTG7_1_40
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 319,352
Atom	Atom Count	Percent	Variation %
Carbon	1,539,065	32.52	> ~0.3154
Hydrogen	1,698,130	35.88	> ~0.2864
Nitrogen	1,177,260	24.87	< ~0.5495
Oxygen	318,399	6.73	< ~0.0523
Totals	4,732,854	100.00	----

Promoter-Terminator Sections
Table: 5619 (Promoter Count: 32)
Link and genome info: NW_018394848.1
Danio rerio strain Tuebingen chromosome 12 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG12_1_20

Nucleotide count: 249,644
Atom	Atom Count	Percent	Variation %
Carbon	1,203,569	32.53	> ~0.3295
Hydrogen	1,327,420	35.88	> ~0.2874
Nitrogen	921,318	24.90	< ~0.5202
Oxygen	247,242	6.68	< ~0.0967
Totals	3,699,549	100.00	----

Promoter-Terminator Sections
Table: 5620 (Promoter Count: 2)
Link and genome info: NW_003336895.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA581

Nucleotide count: 14,083
Atom	Atom Count	Percent	Variation %
Carbon	67,821	32.55	> ~0.3431
Hydrogen	74,839	35.91	> ~0.3211
Nitrogen	51,955	24.93	< ~0.4911
Oxygen	13,767	6.61	< ~0.1731
Totals	208,382	100.00	----

Promoter-Terminator Sections
Table: 5621 (Promoter Count: 59)
Link and genome info: KI270778.1
Homo sapiens chromosome 3 genomic contig
GRCh38 reference assembly alternate locus group ALT_REF_LOCI_1

Nucleotide count: 184,452
Atom	Atom Count	Percent	Variation %
Carbon	891,229	32.56	> ~0.3524
Hydrogen	980,943	35.83	> ~0.2398
Nitrogen	684,149	24.99	< ~0.4323
Oxygen	181,218	6.62	< ~0.1600
Totals	2,737,539	100.00	----

Promoter-Terminator Sections
Table: 5622 (Promoter Count: 2)
Link and genome info: NW_003336721.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA92

Nucleotide count: 13,167
'N' Nucleotide Count: 100
Atom	Atom Count	Percent	Variation %
Carbon	63,704	32.50	> ~0.3010
Hydrogen	70,546	36.00	> ~0.4022
Nitrogen	47,440	24.21	< ~1.2179
Oxygen	14,296	7.29	> ~0.5147
Totals	195,986	100.00	----

Promoter-Terminator Sections
Table: 5623 (Promoter Count: 31)
Link and genome info: NW_018394891.1
Danio rerio strain Tuebingen chromosome 14 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG14_1_1

Nucleotide count: 195,086
Atom	Atom Count	Percent	Variation %
Carbon	939,981	32.51	> ~0.3063
Hydrogen	1,037,341	35.88	> ~0.2837
Nitrogen	718,799	24.86	< ~0.5637
Oxygen	195,267	6.75	< ~0.0263
Totals	2,891,388	100.00	----

Promoter-Terminator Sections
Table: 5624 (Promoter Count: 3)
Link and genome info: KN150661.1
Danio rerio unplaced genomic contig NA991
GRCz11 reference primary assembly

Nucleotide count: 13,141
'N' Nucleotide Count: 300
Atom	Atom Count	Percent	Variation %
Carbon	62,991	32.47	> ~0.2630
Hydrogen	69,488	35.82	> ~0.2218
Nitrogen	48,928	25.22	< ~0.2056
Oxygen	12,612	6.50	< ~0.2793
Totals	194,019	100.00	----

Promoter-Terminator Sections
Table: 5625 (Promoter Count: 1)
Link and genome info: KN150662.1
Danio rerio unplaced genomic contig NA992
GRCz11 reference primary assembly

Nucleotide count: 8,757
'N' Nucleotide Count: 300
Atom	Atom Count	Percent	Variation %
Carbon	42,324	32.61	> ~0.4042
Hydrogen	46,751	36.02	> ~0.4251
Nitrogen	31,965	24.63	< ~0.7970
Oxygen	8,758	6.75	< ~0.0323
Totals	129,798	100.00	----

Promoter-Terminator Sections
Table: 5626 (Promoter Count: 1)
Link and genome info: NT_187483.1
Homo sapiens unplaced genomic scaffold
GRCh38.p14 Primary Assembly HSCHRUN_RANDOM_191

Nucleotide count: 777
Atom	Atom Count	Percent	Variation %
Carbon	3,733	32.49	> ~0.2914
Hydrogen	4,113	35.80	> ~0.2094
Nitrogen	2,897	25.22	< ~0.2061
Oxygen	745	6.49	< ~0.2947
Totals	11,488	100.00	----

Promoter-Terminator Sections
Table: 5627 (Promoter Count: 28)
Link and genome info: KI270749.1
Homo sapiens unplaced genomic contig
GRCh38 reference primary assembly

Nucleotide count: 113,539
Atom	Atom Count	Percent	Variation %
Carbon	547,841	32.53	> ~0.3312
Hydrogen	602,269	35.77	> ~0.1737
Nitrogen	424,265	25.20	< ~0.2279
Oxygen	109,496	6.50	< ~0.2771
Totals	1,683,871	100.00	----

Promoter-Terminator Sections
Table: 5628 (Promoter Count: 2)
Link and genome info: NKLS02001927.1
Bos taurus breed Hereford isolate L1 Dominette 01449 registration number 42190680 Leftover_ScbfJmS_712
whole genome shotgun sequence

Nucleotide count: 45,041
Atom	Atom Count	Percent	Variation %
Carbon	214,526	32.21	> ~0.0020
Hydrogen	236,574	35.52	< ~0.0779
Nitrogen	169,740	25.48	> ~0.0583
Oxygen	45,278	6.80	> ~0.0176
Totals	666,118	100.00	----

Promoter-Terminator Sections
Table: 5629 (Promoter Count: 5)
Link and genome info: KN150282.1
Danio rerio unplaced genomic contig NA636
GRCz11 reference primary assembly

Nucleotide count: 12,162
'N' Nucleotide Count: 100
Atom	Atom Count	Percent	Variation %
Carbon	58,620	32.52	> ~0.3141
Hydrogen	64,663	35.87	> ~0.2765
Nitrogen	44,871	24.89	< ~0.5330
Oxygen	12,118	6.72	< ~0.0576
Totals	180,272	100.00	----

Promoter-Terminator Sections
Table: 5630 (Promoter Count: 11)
Link and genome info: KI270793.1
Homo sapiens chromosome 5 genomic contig
GRCh38 reference assembly alternate locus group ALT_REF_LOCI_1

Nucleotide count: 54,174
Atom	Atom Count	Percent	Variation %
Carbon	256,213	32.11	< ~0.0940
Hydrogen	283,242	35.50	< ~0.0965
Nitrogen	204,440	25.62	> ~0.1973
Oxygen	54,043	6.77	< ~0.0069
Totals	797,938	100.00	----

Promoter-Terminator Sections
Table: 5631 (Promoter Count: 3)
Link and genome info: KZ115956.1
Danio rerio unplaced genomic contig NA569
GRCz11 reference primary assembly

Nucleotide count: 5,295
Atom	Atom Count	Percent	Variation %
Carbon	25,567	32.54	> ~0.3403
Hydrogen	28,073	35.73	> ~0.1404
Nitrogen	19,865	25.29	< ~0.1379
Oxygen	5,057	6.44	< ~0.3427
Totals	78,562	100.00	----

Promoter-Terminator Sections
Table: 5632 (Promoter Count: 3)
Link and genome info: KN150557.1
Danio rerio unplaced genomic contig NA86
GRCz11 reference primary assembly

Nucleotide count: 33,962
'N' Nucleotide Count: 200
Atom	Atom Count	Percent	Variation %
Carbon	163,684	32.46	> ~0.2519
Hydrogen	180,094	35.71	> ~0.1159
Nitrogen	126,706	25.12	< ~0.3004
Oxygen	33,853	6.71	< ~0.0673
Totals	504,337	100.00	----

Promoter-Terminator Sections
Table: 5633 (Promoter Count: 64)
Link and genome info: CM008192.2
Bos taurus isolate L1 Dominette 01449 registration number 42190680 breed Hereford chromosome 25
whole genome shotgun sequence

Nucleotide count: 585,611
Atom	Atom Count	Percent	Variation %
Carbon	2,762,862	32.06	< ~0.1440
Hydrogen	3,053,454	35.43	< ~0.1619
Nitrogen	2,221,472	25.78	> ~0.3536
Oxygen	580,163	6.73	< ~0.0477
Totals	8,617,951	100.00	----

Promoter-Terminator Sections
Table: 5634 (Promoter Count: 58)
Link and genome info: KZ115190.1
Danio rerio chromosome 6 genomic contig ALT_CTG6_1_31
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 228,752
Atom	Atom Count	Percent	Variation %
Carbon	1,103,707	32.54	> ~0.3364
Hydrogen	1,219,223	35.95	> ~0.3522
Nitrogen	837,265	24.68	< ~0.7392
Oxygen	231,676	6.83	> ~0.0506
Totals	3,391,871	100.00	----

Promoter-Terminator Sections
Table: 5635 (Promoter Count: 58)
Link and genome info: NW_018394839.1
Danio rerio strain Tuebingen chromosome 12 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG12_1_11

Nucleotide count: 414,955
Atom	Atom Count	Percent	Variation %
Carbon	2,001,260	32.54	> ~0.3325
Hydrogen	2,207,045	35.88	> ~0.2882
Nitrogen	1,530,935	24.89	< ~0.5342
Oxygen	411,697	6.69	< ~0.0865
Totals	6,150,937	100.00	----

Promoter-Terminator Sections
Table: 5636 (Promoter Count: 54)
Link and genome info: NW_018394548.1
Danio rerio strain Tuebingen chromosome 4 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG4_1_2

Nucleotide count: 287,911
Atom	Atom Count	Percent	Variation %
Carbon	1,388,870	32.54	> ~0.3397
Hydrogen	1,531,863	35.89	> ~0.3004
Nitrogen	1,061,261	24.87	< ~0.5569
Oxygen	285,789	6.70	< ~0.0833
Totals	4,267,783	100.00	----

Promoter-Terminator Sections
Table: 5637 (Promoter Count: 2)
Link and genome info: NKLS02000280.1
Bos taurus breed Hereford isolate L1 Dominette 01449 registration number 42190680 Leftover_ScbfJmS_1260
whole genome shotgun sequence

Nucleotide count: 29,236
Atom	Atom Count	Percent	Variation %
Carbon	139,104	32.27	> ~0.0640
Hydrogen	154,096	35.75	> ~0.1518
Nitrogen	108,280	25.12	< ~0.3064
Oxygen	29,618	6.87	> ~0.0907
Totals	431,098	100.00	----

Promoter-Terminator Sections
Table: 5638 (Promoter Count: 6)
Link and genome info: KZ208914.1
Homo sapiens chromosome 8 genomic contig HG2419_PATCH
GRC reference assembly FIX PATCH for GRCh38

Nucleotide count: 72,541
Atom	Atom Count	Percent	Variation %
Carbon	341,306	31.99	< ~0.2129
Hydrogen	377,043	35.34	< ~0.2531
Nitrogen	276,893	25.95	> ~0.5294
Oxygen	71,657	6.72	< ~0.0633
Totals	1,066,899	100.00	----

Promoter-Terminator Sections
Table: 5639 (Promoter Count: 4)
Link and genome info: NW_003335052.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA580

Nucleotide count: 9,750
'N' Nucleotide Count: 100
Atom	Atom Count	Percent	Variation %
Carbon	47,138	32.48	> ~0.2756
Hydrogen	51,890	35.75	> ~0.1600
Nitrogen	36,106	24.88	< ~0.5460
Oxygen	10,000	6.89	> ~0.1105
Totals	145,134	100.00	----

Promoter-Terminator Sections
Table: 5640 (Promoter Count: 3)
Link and genome info: NW_020191470.1
Bos taurus isolate L1 Dominette 01449 registration number 42190680 breed Hereford unplaced genomic scaffold
ARS-UCD2.0 Leftover_ScbfJmS_2399, whole genome shotgun sequence

Nucleotide count: 3,756
Atom	Atom Count	Percent	Variation %
Carbon	18,016	32.31	> ~0.1019
Hydrogen	19,689	35.31	< ~0.2880
Nitrogen	14,525	26.05	> ~0.6217
Oxygen	3,538	6.34	< ~0.4356
Totals	55,768	100.00	----

Promoter-Terminator Sections
Table: 5641 (Promoter Count: 42)
Link and genome info: MU273344.1
Homo sapiens chromosome 2 genomic contig HG2231_HG2496_PATCH
GRC reference assembly FIX PATCH for GRCh38

Nucleotide count: 143,735
Atom	Atom Count	Percent	Variation %
Carbon	691,489	32.46	> ~0.2543
Hydrogen	765,074	35.91	> ~0.3185
Nitrogen	525,106	24.65	< ~0.7758
Oxygen	148,761	6.98	> ~0.2030
Totals	2,130,430	100.00	----

Promoter-Terminator Sections
Table: 5642 (Promoter Count: 41)
Link and genome info: NW_018394885.1
Danio rerio strain Tuebingen chromosome 13 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG13_1_26

Nucleotide count: 217,442
Atom	Atom Count	Percent	Variation %
Carbon	1,048,002	32.53	> ~0.3282
Hydrogen	1,155,995	35.88	> ~0.2906
Nitrogen	802,439	24.91	< ~0.5148
Oxygen	215,057	6.68	< ~0.1040
Totals	3,221,493	100.00	----

Promoter-Terminator Sections
Table: 5643 (Promoter Count: 49)
Link and genome info: KZ115744.1
Danio rerio chromosome 25 genomic contig ALT_CTG25_1_22
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 220,600
Atom	Atom Count	Percent	Variation %
Carbon	1,063,722	32.52	> ~0.3158
Hydrogen	1,174,335	35.90	> ~0.3075
Nitrogen	810,439	24.78	< ~0.6477
Oxygen	222,565	6.80	> ~0.0244
Totals	3,271,061	100.00	----

Promoter-Terminator Sections
Table: 5644 (Promoter Count: 3)
Link and genome info: KN149771.1
Danio rerio unplaced genomic contig NA159
GRCz11 reference primary assembly

Nucleotide count: 9,392
'N' Nucleotide Count: 100
Atom	Atom Count	Percent	Variation %
Carbon	45,510	32.60	> ~0.3983
Hydrogen	50,317	36.05	> ~0.4520
Nitrogen	33,989	24.35	< ~1.0752
Oxygen	9,778	7.00	> ~0.2249
Totals	139,594	100.00	----

Promoter-Terminator Sections
Table: 5645 (Promoter Count: 1)
Link and genome info: NW_003336451.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA82

Nucleotide count: 6,410
Atom	Atom Count	Percent	Variation %
Carbon	30,676	32.44	> ~0.2346
Hydrogen	33,817	35.76	> ~0.1663
Nitrogen	24,001	25.38	< ~0.0441
Oxygen	6,074	6.42	< ~0.3568
Totals	94,568	100.00	----

Promoter-Terminator Sections
Table: 5646 (Promoter Count: 10)
Link and genome info: KI270519.1
Homo sapiens unplaced genomic contig
GRCh38 reference primary assembly

Nucleotide count: 58,152
'N' Nucleotide Count: 205
Atom	Atom Count	Percent	Variation %
Carbon	280,398	32.50	> ~0.2979
Hydrogen	308,932	35.81	> ~0.2155
Nitrogen	215,520	24.98	< ~0.4425
Oxygen	57,878	6.71	< ~0.0710
Totals	862,728	100.00	----

Promoter-Terminator Sections
Table: 5647 (Promoter Count: 6)
Link and genome info: KN150084.1
Danio rerio unplaced genomic contig NA455
GRCz11 reference primary assembly

Nucleotide count: 13,319
'N' Nucleotide Count: 100
Atom	Atom Count	Percent	Variation %
Carbon	64,241	32.55	> ~0.3501
Hydrogen	70,982	35.97	> ~0.3762
Nitrogen	48,726	24.69	< ~0.7323
Oxygen	13,391	6.79	> ~0.0061
Totals	197,340	100.00	----

Promoter-Terminator Sections
Table: 5648 (Promoter Count: 2)
Link and genome info: NW_021159999.1
Homo sapiens chromosome 9 genomic patch of type FIX
GRCh38.p14 PATCHES HG613_PATCH

Nucleotide count: 10,005
Atom	Atom Count	Percent	Variation %
Carbon	47,431	32.10	< ~0.0995
Hydrogen	52,343	35.43	< ~0.1645
Nitrogen	37,883	25.64	> ~0.2176
Oxygen	10,085	6.83	> ~0.0464
Totals	147,742	100.00	----

Promoter-Terminator Sections
Table: 5649 (Promoter Count: 1)
Link and genome info: KN150412.1
Danio rerio unplaced genomic contig NA764
GRCz11 reference primary assembly

Nucleotide count: 5,392
'N' Nucleotide Count: 200
Atom	Atom Count	Percent	Variation %
Carbon	25,838	32.45	> ~0.2450
Hydrogen	28,671	36.01	> ~0.4130
Nitrogen	19,583	24.59	< ~0.8306
Oxygen	5,536	6.95	> ~0.1726
Totals	79,628	100.00	----

Promoter-Terminator Sections
Table: 5650 (Promoter Count: 28)
Link and genome info: NW_018395012.1
Danio rerio strain Tuebingen chromosome 18 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG18_1_12

Nucleotide count: 113,245
Atom	Atom Count	Percent	Variation %
Carbon	545,724	32.51	> ~0.3058
Hydrogen	602,530	35.89	> ~0.2999
Nitrogen	416,308	24.80	< ~0.6239
Oxygen	114,115	6.80	> ~0.0182
Totals	1,678,677	100.00	----

Promoter-Terminator Sections
Table: 5651 (Promoter Count: 1)
Link and genome info: KN150145.1
Danio rerio unplaced genomic contig NA509
GRCz11 reference primary assembly

Nucleotide count: 1,829
Atom	Atom Count	Percent	Variation %
Carbon	8,828	32.57	> ~0.3626
Hydrogen	9,721	35.86	> ~0.2671
Nitrogen	6,783	25.02	< ~0.4016
Oxygen	1,776	6.55	< ~0.2281
Totals	27,108	100.00	----

Promoter-Terminator Sections
Table: 5652 (Promoter Count: 58)
Link and genome info: NW_018394795.1
Danio rerio strain Tuebingen chromosome 10 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG10_1_33

Nucleotide count: 309,913
Atom	Atom Count	Percent	Variation %
Carbon	1,494,984	32.53	> ~0.3277
Hydrogen	1,650,114	35.91	> ~0.3135
Nitrogen	1,138,756	24.78	< ~0.6442
Oxygen	311,703	6.78	> ~0.0030
Totals	4,595,557	100.00	----

Promoter-Terminator Sections
Table: 5653 (Promoter Count: 30)
Link and genome info: KZ208919.1
Homo sapiens chromosome 14 genomic contig HSCHR14_8_CTG1
GRC reference assembly NOVEL PATCH for GRCh38

Nucleotide count: 123,440
Atom	Atom Count	Percent	Variation %
Carbon	591,954	32.40	> ~0.1984
Hydrogen	651,886	35.68	> ~0.0891
Nitrogen	462,650	25.32	< ~0.0996
Oxygen	120,429	6.59	< ~0.1878
Totals	1,826,919	100.00	----

Promoter-Terminator Sections
Table: 5654 (Promoter Count: 22)
Link and genome info: NT_167209.1
Homo sapiens unplaced genomic scaffold
GRCh38.p14 Primary Assembly HSCHRUN_RANDOM_CTG4

Nucleotide count: 82,988
Atom	Atom Count	Percent	Variation %
Carbon	398,217	32.44	> ~0.2408
Hydrogen	439,610	35.82	> ~0.2235
Nitrogen	307,484	25.05	< ~0.3718
Oxygen	82,079	6.69	< ~0.0924
Totals	1,227,390	100.00	----

Promoter-Terminator Sections
Table: 5655 (Promoter Count: 1)
Link and genome info: NKLS02000111.1
Bos taurus breed Hereford isolate L1 Dominette 01449 registration number 42190680 Leftover_ScbfJmS_1083
whole genome shotgun sequence

Nucleotide count: 4,981
Atom	Atom Count	Percent	Variation %
Carbon	23,565	32.18	< ~0.0213
Hydrogen	26,159	35.72	> ~0.1314
Nitrogen	18,463	25.21	< ~0.2093
Oxygen	5,037	6.88	> ~0.0992
Totals	73,224	100.00	----

Promoter-Terminator Sections
Table: 5656 (Promoter Count: 11)
Link and genome info: KN538368.1
Homo sapiens chromosome 11 genomic contig HSCHR11_1_CTG1_2
GRC reference assembly NOVEL PATCH for GRCh38

Nucleotide count: 59,232
Atom	Atom Count	Percent	Variation %
Carbon	284,703	32.47	> ~0.2683
Hydrogen	312,043	35.59	< ~0.0032
Nitrogen	225,597	25.73	> ~0.3067
Oxygen	54,429	6.21	< ~0.5718
Totals	876,772	100.00	----

Promoter-Terminator Sections
Table: 5657 (Promoter Count: 35)
Link and genome info: NW_018395101.1
Danio rerio strain Tuebingen chromosome 22 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG22_1_4

Nucleotide count: 170,379
Atom	Atom Count	Percent	Variation %
Carbon	821,142	32.52	> ~0.3170
Hydrogen	906,023	35.88	> ~0.2889
Nitrogen	628,005	24.87	< ~0.5522
Oxygen	169,832	6.73	< ~0.0537
Totals	2,525,002	100.00	----

Promoter-Terminator Sections
Table: 5658 (Promoter Count: 1)
Link and genome info: NKLS02001039.1
Bos taurus breed Hereford isolate L1 Dominette 01449 registration number 42190680 Leftover_ScbfJmS_2031
whole genome shotgun sequence

Nucleotide count: 1,306
Atom	Atom Count	Percent	Variation %
Carbon	6,260	32.40	> ~0.1999
Hydrogen	7,004	36.25	> ~0.6613
Nitrogen	4,568	23.65	< ~1.7786
Oxygen	1,487	7.70	> ~0.9174
Totals	19,319	100.00	----

Promoter-Terminator Sections
Table: 5659 (Promoter Count: 3)
Link and genome info: GL383575.2
Homo sapiens chromosome 19 genomic contig
GRCh38 reference assembly alternate locus group ALT_REF_LOCI_1

Nucleotide count: 13,887
Atom	Atom Count	Percent	Variation %
Carbon	66,962	32.52	> ~0.3173
Hydrogen	74,234	36.05	> ~0.4592
Nitrogen	50,092	24.33	< ~1.0961
Oxygen	14,618	7.10	> ~0.3197
Totals	205,906	100.00	----

Promoter-Terminator Sections
Table: 5660 (Promoter Count: 1)
Link and genome info: KN150113.1
Danio rerio unplaced genomic contig NA50
GRCz11 reference primary assembly

Nucleotide count: 15,409
'N' Nucleotide Count: 100
Atom	Atom Count	Percent	Variation %
Carbon	74,437	32.54	> ~0.3367
Hydrogen	82,087	35.88	> ~0.2910
Nitrogen	56,703	24.79	< ~0.6360
Oxygen	15,528	6.79	> ~0.0083
Totals	228,755	100.00	----

Promoter-Terminator Sections
Table: 5661 (Promoter Count: 4)
Link and genome info: KN150297.1
Danio rerio unplaced genomic contig NA648
GRCz11 reference primary assembly

Nucleotide count: 17,056
Atom	Atom Count	Percent	Variation %
Carbon	81,643	32.43	> ~0.2276
Hydrogen	90,654	36.01	> ~0.4172
Nitrogen	61,884	24.58	< ~0.8416
Oxygen	17,563	6.98	> ~0.1968
Totals	251,744	100.00	----

Promoter-Terminator Sections
Table: 5662 (Promoter Count: 5)
Link and genome info: NW_018394498.1
Danio rerio strain Tuebingen chromosome 1 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG1_1_39

Nucleotide count: 24,147
Atom	Atom Count	Percent	Variation %
Carbon	116,757	32.59	> ~0.3895
Hydrogen	128,835	35.96	> ~0.3713
Nitrogen	88,479	24.70	< ~0.7246
Oxygen	24,157	6.74	< ~0.0362
Totals	358,228	100.00	----

Promoter-Terminator Sections
Table: 5663 (Promoter Count: 2)
Link and genome info: NW_020190820.1
Bos taurus isolate L1 Dominette 01449 registration number 42190680 breed Hereford unplaced genomic scaffold
ARS-UCD2.0 Leftover_ScbfJmS_1720, whole genome shotgun sequence

Nucleotide count: 11,995
Atom	Atom Count	Percent	Variation %
Carbon	56,863	32.18	< ~0.0187
Hydrogen	62,922	35.61	> ~0.0209
Nitrogen	44,910	25.42	< ~0.0044
Oxygen	11,982	6.78	> ~0.0022
Totals	176,677	100.00	----

Promoter-Terminator Sections
Table: 5664 (Promoter Count: 21)
Link and genome info: KZ115621.1
Danio rerio chromosome 21 genomic contig ALT_CTG21_1_7
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 147,015
Atom	Atom Count	Percent	Variation %
Carbon	709,713	32.55	> ~0.3471
Hydrogen	781,608	35.85	> ~0.2548
Nitrogen	544,752	24.98	< ~0.4390
Oxygen	144,269	6.62	< ~0.1629
Totals	2,180,342	100.00	----

Promoter-Terminator Sections
Table: 5665 (Promoter Count: 4)
Link and genome info: KN150511.1
Danio rerio unplaced genomic contig NA854
GRCz11 reference primary assembly

Nucleotide count: 29,609
Atom	Atom Count	Percent	Variation %
Carbon	142,209	32.41	> ~0.2111
Hydrogen	156,941	35.77	> ~0.1793
Nitrogen	109,685	25.00	< ~0.4226
Oxygen	29,885	6.81	> ~0.0322
Totals	438,720	100.00	----

Promoter-Terminator Sections
Table: 5666 (Promoter Count: 6)
Link and genome info: NW_003335350.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA909

Nucleotide count: 34,176
'N' Nucleotide Count: 500
Atom	Atom Count	Percent	Variation %
Carbon	164,797	32.53	> ~0.3222
Hydrogen	181,980	35.92	> ~0.3238
Nitrogen	125,414	24.75	< ~0.6710
Oxygen	34,477	6.80	> ~0.0250
Totals	506,668	100.00	----

Promoter-Terminator Sections
Table: 5667 (Promoter Count: 23)
Link and genome info: KN538362.1
Homo sapiens chromosome 2 genomic contig HG2233_PATCH
GRC reference assembly FIX PATCH for GRCh38

Nucleotide count: 128,048
Atom	Atom Count	Percent	Variation %
Carbon	608,828	32.22	> ~0.0195
Hydrogen	671,825	35.56	< ~0.0361
Nitrogen	482,661	25.55	> ~0.1217
Oxygen	126,110	6.67	< ~0.1052
Totals	1,889,424	100.00	----

Promoter-Terminator Sections
Table: 5668 (Promoter Count: 37)
Link and genome info: NW_018394639.1
Danio rerio strain Tuebingen chromosome 6 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG6_1_17

Nucleotide count: 182,801
Atom	Atom Count	Percent	Variation %
Carbon	882,486	32.56	> ~0.3607
Hydrogen	975,189	35.98	> ~0.3917
Nitrogen	667,415	24.63	< ~0.7958
Oxygen	184,903	6.82	> ~0.0433
Totals	2,709,993	100.00	----

Promoter-Terminator Sections
Table: 5669 (Promoter Count: 13)
Link and genome info: KZ208910.1
Homo sapiens chromosome 5 genomic contig HSCHR5_9_CTG1
GRC reference assembly NOVEL PATCH for GRCh38

Nucleotide count: 94,676
Atom	Atom Count	Percent	Variation %
Carbon	453,727	32.38	> ~0.1745
Hydrogen	500,793	35.74	> ~0.1433
Nitrogen	351,835	25.11	< ~0.3168
Oxygen	94,994	6.78	< ~0.0009
Totals	1,401,349	100.00	----

Promoter-Terminator Sections
Table: 5670 (Promoter Count: 36)
Link and genome info: KZ115513.1
Danio rerio chromosome 17 genomic contig ALT_CTG17_1_4
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 195,675
Atom	Atom Count	Percent	Variation %
Carbon	943,085	32.53	> ~0.3220
Hydrogen	1,040,294	35.88	> ~0.2848
Nitrogen	722,038	24.90	< ~0.5218
Oxygen	194,114	6.69	< ~0.0850
Totals	2,899,531	100.00	----

Promoter-Terminator Sections
Table: 5671 (Promoter Count: 105)
Link and genome info: CM008188.2
Bos taurus isolate L1 Dominette 01449 registration number 42190680 breed Hereford chromosome 21
whole genome shotgun sequence

Nucleotide count: 535,822
'N' Nucleotide Count: 25
Atom	Atom Count	Percent	Variation %
Carbon	2,559,225	32.31	> ~0.1074
Hydrogen	2,820,978	35.62	> ~0.0223
Nitrogen	2,013,736	25.42	> ~0.0002
Oxygen	526,716	6.65	< ~0.1298
Totals	7,920,655	100.00	----

Promoter-Terminator Sections
Table: 5672 (Promoter Count: 1)
Link and genome info: KN149922.1
Danio rerio unplaced genomic contig NA302
GRCz11 reference primary assembly

Nucleotide count: 1,758
Atom	Atom Count	Percent	Variation %
Carbon	8,429	32.43	> ~0.2258
Hydrogen	9,290	35.74	> ~0.1486
Nitrogen	6,568	25.27	< ~0.1544
Oxygen	1,705	6.56	< ~0.2200
Totals	25,992	100.00	----

Promoter-Terminator Sections
Table: 5673 (Promoter Count: 31)
Link and genome info: NW_018395129.1
Danio rerio strain Tuebingen chromosome 23 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG23_1_3

Nucleotide count: 194,814
Atom	Atom Count	Percent	Variation %
Carbon	938,579	32.51	> ~0.3057
Hydrogen	1,036,512	35.90	> ~0.3079
Nitrogen	715,762	24.79	< ~0.6322
Oxygen	196,277	6.80	> ~0.0186
Totals	2,887,130	100.00	----

Promoter-Terminator Sections
Table: 5674 (Promoter Count: 2)
Link and genome info: NW_020190988.1
Bos taurus isolate L1 Dominette 01449 registration number 42190680 breed Hereford unplaced genomic scaffold
ARS-UCD2.0 Leftover_ScbfJmS_1893, whole genome shotgun sequence

Nucleotide count: 3,515
Atom	Atom Count	Percent	Variation %
Carbon	16,752	32.31	> ~0.1064
Hydrogen	18,515	35.71	> ~0.1170
Nitrogen	13,109	25.28	< ~0.1402
Oxygen	3,472	6.70	< ~0.0832
Totals	51,848	100.00	----

Promoter-Terminator Sections
Table: 5675 (Promoter Count: 2)
Link and genome info: NKLS02000376.1
Bos taurus breed Hereford isolate L1 Dominette 01449 registration number 42190680 Leftover_ScbfJmS_1360
whole genome shotgun sequence

Nucleotide count: 7,588
Atom	Atom Count	Percent	Variation %
Carbon	36,393	32.40	> ~0.1934
Hydrogen	39,816	35.44	< ~0.1492
Nitrogen	29,218	26.01	> ~0.5860
Oxygen	6,908	6.15	< ~0.6302
Totals	112,335	100.00	----

Promoter-Terminator Sections
Table: 5676 (Promoter Count: 41)
Link and genome info: NW_018395049.1
Danio rerio strain Tuebingen chromosome 18 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG18_1_49

Nucleotide count: 204,006
Atom	Atom Count	Percent	Variation %
Carbon	981,314	32.49	> ~0.2846
Hydrogen	1,081,373	35.80	> ~0.2074
Nitrogen	758,569	25.11	< ~0.3101
Oxygen	199,291	6.60	< ~0.1819
Totals	3,020,547	100.00	----

Promoter-Terminator Sections
Table: 5677 (Promoter Count: 3)
Link and genome info: NKLS02000560.1
Bos taurus breed Hereford isolate L1 Dominette 01449 registration number 42190680 Leftover_ScbfJmS_1544
whole genome shotgun sequence

Nucleotide count: 6,682
Atom	Atom Count	Percent	Variation %
Carbon	32,283	32.55	> ~0.3459
Hydrogen	35,392	35.68	> ~0.0907
Nitrogen	25,210	25.42	< ~0.0058
Oxygen	6,297	6.35	< ~0.4308
Totals	99,182	100.00	----

Promoter-Terminator Sections
Table: 5678 (Promoter Count: 5)
Link and genome info: KN150408.1
Danio rerio unplaced genomic contig NA759
GRCz11 reference primary assembly

Nucleotide count: 23,015
'N' Nucleotide Count: 200
Atom	Atom Count	Percent	Variation %
Carbon	110,465	32.43	> ~0.2284
Hydrogen	121,907	35.79	> ~0.1979
Nitrogen	85,359	25.06	< ~0.3629
Oxygen	22,876	6.72	< ~0.0635
Totals	340,607	100.00	----

Promoter-Terminator Sections
Table: 5679 (Promoter Count: 1)
Link and genome info: KN150314.1
Danio rerio unplaced genomic contig NA671
GRCz11 reference primary assembly

Nucleotide count: 2,630
Atom	Atom Count	Percent	Variation %
Carbon	12,728	32.59	> ~0.3915
Hydrogen	14,020	35.90	> ~0.3104
Nitrogen	9,696	24.83	< ~0.5934
Oxygen	2,605	6.67	< ~0.1086
Totals	39,049	100.00	----

Promoter-Terminator Sections
Table: 5680 (Promoter Count: 5)
Link and genome info: NKLS02001539.1
Bos taurus breed Hereford isolate L1 Dominette 01449 registration number 42190680 Leftover_ScbfJmS_31
whole genome shotgun sequence

Nucleotide count: 15,690
Atom	Atom Count	Percent	Variation %
Carbon	75,213	32.39	> ~0.1825
Hydrogen	82,641	35.58	< ~0.0089
Nitrogen	59,403	25.58	> ~0.1546
Oxygen	14,983	6.45	< ~0.3282
Totals	232,240	100.00	----

Promoter-Terminator Sections
Table: 5681 (Promoter Count: 6)
Link and genome info: NKLS02001110.1
Bos taurus breed Hereford isolate L1 Dominette 01449 registration number 42190680 Leftover_ScbfJmS_211
whole genome shotgun sequence

Nucleotide count: 21,188
Atom	Atom Count	Percent	Variation %
Carbon	102,042	32.50	> ~0.2941
Hydrogen	113,061	36.01	> ~0.4135
Nitrogen	76,781	24.45	< ~0.9712
Oxygen	22,116	7.04	> ~0.2636
Totals	314,000	100.00	----

Promoter-Terminator Sections
Table: 5682 (Promoter Count: 50)
Link and genome info: NT_187061.1
Mus musculus strain C57BL/6J chromosome Y unlocalized genomic scaffold
GRCm39 MMCHRY_CTGU2

Nucleotide count: 169,346
Atom	Atom Count	Percent	Variation %
Carbon	815,028	32.47	> ~0.2711
Hydrogen	897,094	35.74	> ~0.1512
Nitrogen	632,234	25.19	< ~0.2325
Oxygen	165,390	6.59	< ~0.1898
Totals	2,509,746	100.00	----

Promoter-Terminator Sections
Table: 5683 (Promoter Count: 2)
Link and genome info: NKLS02000481.1
Bos taurus breed Hereford isolate L1 Dominette 01449 registration number 42190680 Leftover_ScbfJmS_1464
whole genome shotgun sequence

Nucleotide count: 1,561
Atom	Atom Count	Percent	Variation %
Carbon	7,553	32.57	> ~0.3681
Hydrogen	8,371	36.10	> ~0.5058
Nitrogen	5,603	24.16	< ~1.2614
Oxygen	1,662	7.17	> ~0.3875
Totals	23,189	100.00	----

Promoter-Terminator Sections
Table: 5684 (Promoter Count: 3)
Link and genome info: KN149767.1
Danio rerio unplaced genomic contig NA156
GRCz11 reference primary assembly

Nucleotide count: 3,070
Atom	Atom Count	Percent	Variation %
Carbon	14,629	32.38	> ~0.1724
Hydrogen	16,125	35.69	> ~0.0934
Nitrogen	11,583	25.63	> ~0.2109
Oxygen	2,848	6.30	< ~0.4767
Totals	45,185	100.00	----

Promoter-Terminator Sections
Table: 5685 (Promoter Count: 37)
Link and genome info: KV766199.1
Homo sapiens chromosome X genomic contig HSCHRX_3_CTG7
GRC reference assembly NOVEL PATCH for GRCh38

Nucleotide count: 145,061
Atom	Atom Count	Percent	Variation %
Carbon	699,343	32.52	> ~0.3183
Hydrogen	771,044	35.86	> ~0.2628
Nitrogen	536,164	24.93	< ~0.4904
Oxygen	143,838	6.69	< ~0.0908
Totals	2,150,389	100.00	----

Promoter-Terminator Sections
Table: 5686 (Promoter Count: 23)
Link and genome info: KZ115697.1
Danio rerio chromosome 23 genomic contig ALT_CTG23_1_34
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 190,233
Atom	Atom Count	Percent	Variation %
Carbon	916,298	32.53	> ~0.3275
Hydrogen	1,010,973	35.89	> ~0.2989
Nitrogen	702,007	24.92	< ~0.5007
Oxygen	187,424	6.65	< ~0.1257
Totals	2,816,702	100.00	----

Promoter-Terminator Sections
Table: 5687 (Promoter Count: 29)
Link and genome info: KZ115751.1
Danio rerio chromosome 6 genomic contig ALT_CTG6_3_1
GRCz11 reference assembly alternate locus group ALT_DRER_TU_3

Nucleotide count: 197,806
Atom	Atom Count	Percent	Variation %
Carbon	953,365	32.52	> ~0.3203
Hydrogen	1,052,525	35.91	> ~0.3133
Nitrogen	727,215	24.81	< ~0.6150
Oxygen	198,191	6.76	< ~0.0185
Totals	2,931,296	100.00	----

Promoter-Terminator Sections
Table: 5688 (Promoter Count: 1)
Link and genome info: NW_003337247.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA278

Nucleotide count: 5,719
Atom	Atom Count	Percent	Variation %
Carbon	27,363	32.39	> ~0.1854
Hydrogen	30,301	35.87	> ~0.2732
Nitrogen	21,013	24.87	< ~0.5512
Oxygen	5,806	6.87	> ~0.0927
Totals	84,483	100.00	----

Promoter-Terminator Sections
Table: 5689 (Promoter Count: 10)
Link and genome info: NW_018394799.1
Danio rerio strain Tuebingen chromosome 10 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG10_1_37

Nucleotide count: 60,905
Atom	Atom Count	Percent	Variation %
Carbon	293,021	32.50	> ~0.2931
Hydrogen	323,564	35.88	> ~0.2906
Nitrogen	224,400	24.89	< ~0.5373
Oxygen	60,714	6.73	< ~0.0464
Totals	901,699	100.00	----

Promoter-Terminator Sections
Table: 5690 (Promoter Count: 18)
Link and genome info: ML143362.1
Homo sapiens chromosome 12 genomic contig HG1398_PATCH
GRC reference assembly FIX PATCH for GRCh38

Nucleotide count: 67,565
Atom	Atom Count	Percent	Variation %
Carbon	323,199	32.29	> ~0.0829
Hydrogen	356,581	35.62	> ~0.0278
Nitrogen	252,305	25.20	< ~0.2195
Oxygen	68,957	6.89	> ~0.1088
Totals	1,001,042	100.00	----

Promoter-Terminator Sections
Table: 5691 (Promoter Count: 15)
Link and genome info: KN196485.1
Homo sapiens chromosome 22 genomic contig HSCHR22_4_CTG1
GRC reference assembly NOVEL PATCH for GRCh38

Nucleotide count: 109,309
Atom	Atom Count	Percent	Variation %
Carbon	520,959	32.29	> ~0.0817
Hydrogen	574,343	35.59	> ~0.0002
Nitrogen	411,979	25.53	> ~0.1076
Oxygen	106,341	6.59	< ~0.1895
Totals	1,613,622	100.00	----

Promoter-Terminator Sections
Table: 5692 (Promoter Count: 96)
Link and genome info: KZ115249.1
Danio rerio chromosome 7 genomic contig ALT_CTG7_1_42
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 538,979
Atom	Atom Count	Percent	Variation %
Carbon	2,598,051	32.52	> ~0.3200
Hydrogen	2,867,081	35.89	> ~0.2980
Nitrogen	1,984,649	24.84	< ~0.5791
Oxygen	538,470	6.74	< ~0.0389
Totals	7,988,251	100.00	----

Promoter-Terminator Sections
Table: 5693 (Promoter Count: 2)
Link and genome info: KN150505.1
Danio rerio unplaced genomic contig NA848
GRCz11 reference primary assembly

Nucleotide count: 29,071
'N' Nucleotide Count: 200
Atom	Atom Count	Percent	Variation %
Carbon	140,724	32.59	> ~0.3877
Hydrogen	154,442	35.77	> ~0.1749
Nitrogen	108,832	25.21	< ~0.2187
Oxygen	27,789	6.44	< ~0.3439
Totals	431,787	100.00	----

Promoter-Terminator Sections
Table: 5694 (Promoter Count: 1)
Link and genome info: KZ116031.1
Danio rerio unplaced genomic contig NA462
GRCz11 reference primary assembly

Nucleotide count: 11,702
'N' Nucleotide Count: 200
Atom	Atom Count	Percent	Variation %
Carbon	56,248	32.47	> ~0.2677
Hydrogen	62,140	35.87	> ~0.2792
Nitrogen	43,096	24.88	< ~0.5451
Oxygen	11,741	6.78	< ~0.0018
Totals	173,225	100.00	----

Promoter-Terminator Sections
Table: 5695 (Promoter Count: 2)
Link and genome info: KZ115990.1
Danio rerio unplaced genomic contig NA425
GRCz11 reference primary assembly

Nucleotide count: 4,799
Atom	Atom Count	Percent	Variation %
Carbon	23,162	32.54	> ~0.3334
Hydrogen	25,467	35.77	> ~0.1816
Nitrogen	17,913	25.16	< ~0.2604
Oxygen	4,645	6.53	< ~0.2546
Totals	71,187	100.00	----

Promoter-Terminator Sections
Table: 5696 (Promoter Count: 4)
Link and genome info: NW_020190918.1
Bos taurus isolate L1 Dominette 01449 registration number 42190680 breed Hereford unplaced genomic scaffold
ARS-UCD2.0 Leftover_ScbfJmS_1819, whole genome shotgun sequence

Nucleotide count: 18,400
Atom	Atom Count	Percent	Variation %
Carbon	87,432	32.33	> ~0.1275
Hydrogen	96,438	35.66	> ~0.0679
Nitrogen	69,550	25.72	> ~0.2947
Oxygen	17,009	6.29	< ~0.4901
Totals	270,429	100.00	----

Promoter-Terminator Sections
Table: 5697 (Promoter Count: 33)
Link and genome info: NC_007125.7
Danio rerio strain Tuebingen chromosome 14
GRCz11 Primary Assembly

Nucleotide count: 266,404
'N' Nucleotide Count: 2,806
Atom	Atom Count	Percent	Variation %
Carbon	1,276,362	32.39	> ~0.1866
Hydrogen	1,411,145	35.81	> ~0.2171
Nitrogen	983,329	24.95	< ~0.4700
Oxygen	269,771	6.85	> ~0.0662
Totals	3,940,607	100.00	----

Promoter-Terminator Sections
Table: 5698 (Promoter Count: 28)
Link and genome info: NW_018394925.1
Danio rerio strain Tuebingen chromosome 14 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG14_1_35

Nucleotide count: 142,508
Atom	Atom Count	Percent	Variation %
Carbon	687,567	32.54	> ~0.3412
Hydrogen	757,964	35.88	> ~0.2835
Nitrogen	526,322	24.91	< ~0.5113
Oxygen	140,839	6.67	< ~0.1134
Totals	2,112,692	100.00	----

Promoter-Terminator Sections
Table: 5699 (Promoter Count: 14)
Link and genome info: NW_003334254.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA864

Nucleotide count: 79,724
'N' Nucleotide Count: 1,001
Atom	Atom Count	Percent	Variation %
Carbon	385,043	32.54	> ~0.3397
Hydrogen	425,170	35.93	> ~0.3414
Nitrogen	291,816	24.66	< ~0.7600
Oxygen	81,149	6.86	> ~0.0789
Totals	1,183,178	100.00	----

Promoter-Terminator Sections
Table: 5700 (Promoter Count: 3)
Link and genome info: NKLS02000159.1
Bos taurus breed Hereford isolate L1 Dominette 01449 registration number 42190680 Leftover_ScbfJmS_1134
whole genome shotgun sequence

Nucleotide count: 5,790
Atom	Atom Count	Percent	Variation %
Carbon	27,619	32.39	> ~0.1901
Hydrogen	30,667	35.97	> ~0.3752
Nitrogen	21,137	24.79	< ~0.6328
Oxygen	5,838	6.85	> ~0.0675
Totals	85,261	100.00	----

Promoter-Terminator Sections
Table: 5701 (Promoter Count: 9)
Link and genome info: NKLS02000995.1
Bos taurus breed Hereford isolate L1 Dominette 01449 registration number 42190680 Leftover_ScbfJmS_1989_199
whole genome shotgun sequence

Nucleotide count: 24,916
Atom	Atom Count	Percent	Variation %
Carbon	119,829	32.44	> ~0.2347
Hydrogen	132,879	35.97	> ~0.3776
Nitrogen	90,181	24.41	< ~1.0114
Oxygen	26,519	7.18	> ~0.3991
Totals	369,408	100.00	----

Promoter-Terminator Sections
Table: 5702 (Promoter Count: 52)
Link and genome info: KZ115088.1
Danio rerio chromosome 4 genomic contig ALT_CTG4_1_5
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 299,584
Atom	Atom Count	Percent	Variation %
Carbon	1,443,488	32.53	> ~0.3309
Hydrogen	1,593,464	35.91	> ~0.3214
Nitrogen	1,102,424	24.85	< ~0.5765
Oxygen	297,442	6.70	< ~0.0758
Totals	4,436,818	100.00	----

Promoter-Terminator Sections
Table: 5703 (Promoter Count: 23)
Link and genome info: NW_018395048.1
Danio rerio strain Tuebingen chromosome 18 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG18_1_48

Nucleotide count: 157,912
Atom	Atom Count	Percent	Variation %
Carbon	762,480	32.55	> ~0.3508
Hydrogen	842,624	35.98	> ~0.3827
Nitrogen	576,208	24.60	< ~0.8224
Oxygen	160,875	6.87	> ~0.0889
Totals	2,342,187	100.00	----

Promoter-Terminator Sections
Table: 5704 (Promoter Count: 3)
Link and genome info: NW_008805463.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA577

Nucleotide count: 3,831
Atom	Atom Count	Percent	Variation %
Carbon	18,569	32.67	> ~0.4649
Hydrogen	20,513	36.09	> ~0.4952
Nitrogen	13,909	24.47	< ~0.9537
Oxygen	3,850	6.77	< ~0.0064
Totals	56,841	100.00	----

Promoter-Terminator Sections
Table: 5705 (Promoter Count: 18)
Link and genome info: NT_187602.1
Homo sapiens chromosome 15 genomic scaffold
GRCh38.p14 alternate locus group ALT_REF_LOCI_1 HSCHR15_1_CTG1

Nucleotide count: 61,872
Atom	Atom Count	Percent	Variation %
Carbon	297,406	32.50	> ~0.2953
Hydrogen	328,073	35.85	> ~0.2566
Nitrogen	229,313	25.06	< ~0.3658
Oxygen	60,340	6.59	< ~0.1861
Totals	915,132	100.00	----

Promoter-Terminator Sections
Table: 5706 (Promoter Count: 4)
Link and genome info: KN149970.1
Danio rerio unplaced genomic contig NA345
GRCz11 reference primary assembly

Nucleotide count: 12,657
Atom	Atom Count	Percent	Variation %
Carbon	60,878	32.52	> ~0.3166
Hydrogen	67,068	35.83	> ~0.2333
Nitrogen	47,122	25.17	< ~0.2520
Oxygen	12,134	6.48	< ~0.2979
Totals	187,202	100.00	----

Promoter-Terminator Sections
Table: 5707 (Promoter Count: 4)
Link and genome info: KN150122.1
Danio rerio unplaced genomic contig NA485
GRCz11 reference primary assembly

Nucleotide count: 49,531
'N' Nucleotide Count: 500
Atom	Atom Count	Percent	Variation %
Carbon	238,149	32.50	> ~0.2939
Hydrogen	262,248	35.79	> ~0.1926
Nitrogen	184,864	25.23	< ~0.1975
Oxygen	47,565	6.49	< ~0.2891
Totals	732,826	100.00	----

Promoter-Terminator Sections
Table: 5708 (Promoter Count: 57)
Link and genome info: NW_017852933.1
Homo sapiens chromosome 16 genomic patch of type FIX
GRCh38.p14 PATCHES HG926_PATCH

Nucleotide count: 189,808
Atom	Atom Count	Percent	Variation %
Carbon	908,605	32.37	> ~0.1653
Hydrogen	1,004,287	35.78	> ~0.1842
Nitrogen	702,429	25.02	< ~0.3999
Oxygen	191,724	6.83	> ~0.0504
Totals	2,807,045	100.00	----

Promoter-Terminator Sections
Table: 5709 (Promoter Count: 3)
Link and genome info: NT_187450.1
Homo sapiens unplaced genomic scaffold
GRCh38.p14 Primary Assembly HSCHRUN_RANDOM_158

Nucleotide count: 16,977
Atom	Atom Count	Percent	Variation %
Carbon	81,568	32.52	> ~0.3200
Hydrogen	90,079	35.92	> ~0.3238
Nitrogen	62,669	24.99	< ~0.4359
Oxygen	16,482	6.57	< ~0.2079
Totals	250,798	100.00	----

Promoter-Terminator Sections
Table: 5710 (Promoter Count: 106)
Link and genome info: CM008197.2
Bos taurus isolate L1 Dominette 01449 registration number 42190680 breed Hereford chromosome X
whole genome shotgun sequence

Nucleotide count: 365,834
'N' Nucleotide Count: 25
Atom	Atom Count	Percent	Variation %
Carbon	1,758,863	32.46	> ~0.2560
Hydrogen	1,936,003	35.73	> ~0.1353
Nitrogen	1,368,057	25.25	< ~0.1765
Oxygen	355,729	6.56	< ~0.2148
Totals	5,418,652	100.00	----

Promoter-Terminator Sections
Table: 5711 (Promoter Count: 42)
Link and genome info: KZ115281.1
Danio rerio chromosome 9 genomic contig ALT_CTG9_1_2
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 271,444
Atom	Atom Count	Percent	Variation %
Carbon	1,306,119	32.49	> ~0.2851
Hydrogen	1,440,996	35.84	> ~0.2502
Nitrogen	1,003,690	24.97	< ~0.4579
Oxygen	269,448	6.70	< ~0.0774
Totals	4,020,253	100.00	----

Promoter-Terminator Sections
Table: 5712 (Promoter Count: 14)
Link and genome info: NW_021160003.1
Homo sapiens chromosome 11 genomic patch of type FIX
GRCh38.p14 PATCHES HG1445_PATCH

Nucleotide count: 59,152
Atom	Atom Count	Percent	Variation %
Carbon	285,367	32.54	> ~0.3396
Hydrogen	314,719	35.89	> ~0.2971
Nitrogen	218,097	24.87	< ~0.5521
Oxygen	58,708	6.70	< ~0.0847
Totals	876,891	100.00	----

Promoter-Terminator Sections
Table: 5713 (Promoter Count: 20)
Link and genome info: CM002889.2
Danio rerio chromosome 5
GRCz11 reference primary assembly

Nucleotide count: 149,623
'N' Nucleotide Count: 2,505
Atom	Atom Count	Percent	Variation %
Carbon	717,072	32.42	> ~0.2149
Hydrogen	788,911	35.67	> ~0.0729
Nitrogen	563,641	25.48	> ~0.0581
Oxygen	142,309	6.43	< ~0.3460
Totals	2,211,933	100.00	----

Promoter-Terminator Sections
Table: 5714 (Promoter Count: 6)
Link and genome info: NW_003337062.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA331

Nucleotide count: 22,416
'N' Nucleotide Count: 100
Atom	Atom Count	Percent	Variation %
Carbon	108,029	32.53	> ~0.3231
Hydrogen	118,973	35.82	> ~0.2284
Nitrogen	83,299	25.08	< ~0.3432
Oxygen	21,825	6.57	< ~0.2084
Totals	332,126	100.00	----

Promoter-Terminator Sections
Table: 5715 (Promoter Count: 77)
Link and genome info: NW_018395323.1
Danio rerio strain Tuebingen chromosome 15 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_2 ALT_CTG15_2_4

Nucleotide count: 408,859
Atom	Atom Count	Percent	Variation %
Carbon	1,970,488	32.53	> ~0.3285
Hydrogen	2,175,824	35.92	> ~0.3287
Nitrogen	1,502,094	24.80	< ~0.6248
Oxygen	408,685	6.75	< ~0.0325
Totals	6,057,091	100.00	----

Promoter-Terminator Sections
Table: 5716 (Promoter Count: 68)
Link and genome info: NW_003571061.2
Homo sapiens chromosome 19 genomic scaffold
GRCh38.p14 alternate locus group ALT_REF_LOCI_8 HSCHR19LRC_PGF2_CTG3_1

Nucleotide count: 372,480
'N' Nucleotide Count: 18,000
Atom	Atom Count	Percent	Variation %
Carbon	1,771,956	32.23	> ~0.0277
Hydrogen	1,956,995	35.60	> ~0.0037
Nitrogen	1,397,727	25.42	> ~0.0004
Oxygen	370,973	6.75	< ~0.0319
Totals	5,497,651	100.00	----

Promoter-Terminator Sections
Table: 5717 (Promoter Count: 42)
Link and genome info: KZ115186.1
Danio rerio chromosome 6 genomic contig ALT_CTG6_1_27
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 199,318
Atom	Atom Count	Percent	Variation %
Carbon	961,905	32.54	> ~0.3363
Hydrogen	1,060,691	35.88	> ~0.2883
Nitrogen	734,917	24.86	< ~0.5627
Oxygen	198,585	6.72	< ~0.0619
Totals	2,956,098	100.00	----

Promoter-Terminator Sections
Table: 5718 (Promoter Count: 1)
Link and genome info: NKLS02001269.1
Bos taurus breed Hereford isolate L1 Dominette 01449 registration number 42190680 Leftover_ScbfJmS_2278
whole genome shotgun sequence

Nucleotide count: 723
Atom	Atom Count	Percent	Variation %
Carbon	3,461	32.49	> ~0.2882
Hydrogen	3,846	36.11	> ~0.5127
Nitrogen	2,614	24.54	< ~0.8837
Oxygen	731	6.86	> ~0.0829
Totals	10,652	100.00	----

Promoter-Terminator Sections
Table: 5719 (Promoter Count: 70)
Link and genome info: KZ115280.1
Danio rerio chromosome 9 genomic contig ALT_CTG9_1_1
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 414,005
Atom	Atom Count	Percent	Variation %
Carbon	1,994,366	32.51	> ~0.3052
Hydrogen	2,204,129	35.93	> ~0.3346
Nitrogen	1,516,395	24.72	< ~0.7061
Oxygen	419,997	6.85	> ~0.0663
Totals	6,134,887	100.00	----

Promoter-Terminator Sections
Table: 5720 (Promoter Count: 5)
Link and genome info: NW_003336426.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA881

Nucleotide count: 20,340
'N' Nucleotide Count: 300
Atom	Atom Count	Percent	Variation %
Carbon	98,532	32.61	> ~0.4038
Hydrogen	108,500	35.91	> ~0.3127
Nitrogen	74,964	24.81	< ~0.6159
Oxygen	20,183	6.68	< ~0.1005
Totals	302,179	100.00	----

Promoter-Terminator Sections
Table: 5721 (Promoter Count: 16)
Link and genome info: KV575256.1
Homo sapiens chromosome 19 genomic contig HSCHR19KIR_0019-4656-B_CTG3_1
GRC reference assembly NOVEL PATCH for GRCh38

Nucleotide count: 158,000
Atom	Atom Count	Percent	Variation %
Carbon	754,353	32.28	> ~0.0756
Hydrogen	830,583	35.54	< ~0.0523
Nitrogen	596,957	25.54	> ~0.1203
Oxygen	155,084	6.64	< ~0.1436
Totals	2,336,977	100.00	----

Promoter-Terminator Sections
Table: 5722 (Promoter Count: 12)
Link and genome info: NW_020190183.1
Bos taurus isolate L1 Dominette 01449 registration number 42190680 breed Hereford unplaced genomic scaffold
ARS-UCD2.0 Leftover_ScbfJmS_1072, whole genome shotgun sequence

Nucleotide count: 55,135
Atom	Atom Count	Percent	Variation %
Carbon	264,130	32.38	> ~0.1788
Hydrogen	292,175	35.82	> ~0.2273
Nitrogen	203,085	24.90	< ~0.5256
Oxygen	56,274	6.90	> ~0.1195
Totals	815,664	100.00	----

Promoter-Terminator Sections
Table: 5723 (Promoter Count: 12)
Link and genome info: KI270435.1
Homo sapiens unplaced genomic contig
GRCh38 reference primary assembly

Nucleotide count: 45,886
'N' Nucleotide Count: 20
Atom	Atom Count	Percent	Variation %
Carbon	221,852	32.51	> ~0.3111
Hydrogen	244,465	35.83	> ~0.2354
Nitrogen	169,169	24.79	< ~0.6304
Oxygen	46,832	6.86	> ~0.0840
Totals	682,318	100.00	----

Promoter-Terminator Sections
Table: 5724 (Promoter Count: 3)
Link and genome info: NKLS02001628.1
Bos taurus breed Hereford isolate L1 Dominette 01449 registration number 42190680 Leftover_ScbfJmS_405
whole genome shotgun sequence

Nucleotide count: 1,702
Atom	Atom Count	Percent	Variation %
Carbon	8,083	32.40	> ~0.2012
Hydrogen	9,106	36.51	> ~0.9126
Nitrogen	5,868	23.52	< ~1.8990
Oxygen	1,887	7.56	> ~0.7852
Totals	24,944	100.00	----

Promoter-Terminator Sections
Table: 5725 (Promoter Count: 2)
Link and genome info: KN150302.1
Danio rerio unplaced genomic contig NA65
GRCz11 reference primary assembly

Nucleotide count: 8,356
Atom	Atom Count	Percent	Variation %
Carbon	40,287	32.52	> ~0.3129
Hydrogen	44,574	35.98	> ~0.3832
Nitrogen	30,412	24.55	< ~0.8777
Oxygen	8,625	6.96	> ~0.1817
Totals	123,898	100.00	----

Promoter-Terminator Sections
Table: 5726 (Promoter Count: 5)
Link and genome info: KN150676.1
Danio rerio unplaced genomic contig NA1006
GRCz11 reference primary assembly

Nucleotide count: 33,961
'N' Nucleotide Count: 300
Atom	Atom Count	Percent	Variation %
Carbon	163,195	32.46	> ~0.2595
Hydrogen	180,181	35.84	> ~0.2485
Nitrogen	125,457	24.96	< ~0.4677
Oxygen	33,880	6.74	< ~0.0403
Totals	502,713	100.00	----

Promoter-Terminator Sections
Table: 5727 (Promoter Count: 33)
Link and genome info: KZ115709.1
Danio rerio chromosome 24 genomic contig ALT_CTG24_1_9
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 234,998
Atom	Atom Count	Percent	Variation %
Carbon	1,133,195	32.54	> ~0.3405
Hydrogen	1,249,243	35.88	> ~0.2835
Nitrogen	868,641	24.95	< ~0.4774
Oxygen	230,971	6.63	< ~0.1465
Totals	3,482,050	100.00	----

Promoter-Terminator Sections
Table: 5728 (Promoter Count: 19)
Link and genome info: MU273383.1
Homo sapiens chromosome 17 genomic contig HG2580_PATCH
GRC reference assembly FIX PATCH for GRCh38

Nucleotide count: 90,315
Atom	Atom Count	Percent	Variation %
Carbon	429,733	32.23	> ~0.0242
Hydrogen	475,142	35.63	> ~0.0398
Nitrogen	337,190	25.29	< ~0.1363
Oxygen	91,367	6.85	> ~0.0723
Totals	1,333,432	100.00	----

Promoter-Terminator Sections
Table: 5729 (Promoter Count: 34)
Link and genome info: KZ115572.1
Danio rerio chromosome 18 genomic contig ALT_CTG18_1_35
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 218,185
Atom	Atom Count	Percent	Variation %
Carbon	1,049,691	32.49	> ~0.2821
Hydrogen	1,158,580	35.86	> ~0.2621
Nitrogen	805,492	24.93	< ~0.4956
Oxygen	217,501	6.73	< ~0.0486
Totals	3,231,264	100.00	----

Promoter-Terminator Sections
Table: 5730 (Promoter Count: 23)
Link and genome info: KZ115142.1
Danio rerio chromosome 5 genomic contig ALT_CTG5_1_44
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 210,386
Atom	Atom Count	Percent	Variation %
Carbon	1,015,918	32.56	> ~0.3533
Hydrogen	1,121,105	35.93	> ~0.3344
Nitrogen	772,381	24.75	< ~0.6715
Oxygen	211,049	6.76	< ~0.0163
Totals	3,120,453	100.00	----

Promoter-Terminator Sections
Table: 5731 (Promoter Count: 24)
Link and genome info: NW_018394672.1
Danio rerio strain Tuebingen chromosome 7 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG7_1_2

Nucleotide count: 142,197
Atom	Atom Count	Percent	Variation %
Carbon	684,938	32.50	> ~0.2930
Hydrogen	756,308	35.88	> ~0.2894
Nitrogen	522,922	24.81	< ~0.6140
Oxygen	143,564	6.81	> ~0.0316
Totals	2,107,732	100.00	----

Promoter-Terminator Sections
Table: 5732 (Promoter Count: 16)
Link and genome info: KI270845.1
Homo sapiens chromosome 14 genomic contig
GRCh38 reference assembly alternate locus group ALT_REF_LOCI_1

Nucleotide count: 107,770
Atom	Atom Count	Percent	Variation %
Carbon	511,735	32.21	> ~0.0105
Hydrogen	564,398	35.53	< ~0.0642
Nitrogen	407,976	25.68	> ~0.2585
Oxygen	104,445	6.57	< ~0.2049
Totals	1,588,554	100.00	----

Promoter-Terminator Sections
Table: 5733 (Promoter Count: 45)
Link and genome info: KZ115000.1
Danio rerio chromosome 1 genomic contig ALT_CTG1_1_4
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 211,486
Atom	Atom Count	Percent	Variation %
Carbon	1,020,000	32.55	> ~0.3476
Hydrogen	1,123,739	35.86	> ~0.2684
Nitrogen	783,643	25.01	< ~0.4155
Oxygen	206,158	6.58	< ~0.2006
Totals	3,133,540	100.00	----

Promoter-Terminator Sections
Table: 5734 (Promoter Count: 52)
Link and genome info: NW_018394725.1
Danio rerio strain Tuebingen chromosome 8 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG8_1_10

Nucleotide count: 417,530
Atom	Atom Count	Percent	Variation %
Carbon	2,012,625	32.53	> ~0.3299
Hydrogen	2,220,732	35.90	> ~0.3040
Nitrogen	1,538,354	24.87	< ~0.5568
Oxygen	414,650	6.70	< ~0.0771
Totals	6,186,361	100.00	----

Promoter-Terminator Sections
Table: 5735 (Promoter Count: 52)
Link and genome info: KZ115515.1
Danio rerio chromosome 17 genomic contig ALT_CTG17_1_6
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 222,227
Atom	Atom Count	Percent	Variation %
Carbon	1,071,966	32.54	> ~0.3351
Hydrogen	1,180,919	35.85	> ~0.2525
Nitrogen	823,445	24.99	< ~0.4288
Oxygen	218,125	6.62	< ~0.1587
Totals	3,294,455	100.00	----

Promoter-Terminator Sections
Table: 5736 (Promoter Count: 15)
Link and genome info: NW_018394589.1
Danio rerio strain Tuebingen chromosome 5 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG5_1_28

Nucleotide count: 104,561
Atom	Atom Count	Percent	Variation %
Carbon	503,809	32.53	> ~0.3298
Hydrogen	555,327	35.86	> ~0.2668
Nitrogen	387,247	25.01	< ~0.4174
Oxygen	102,215	6.60	< ~0.1792
Totals	1,548,598	100.00	----

Promoter-Terminator Sections
Table: 5737 (Promoter Count: 4)
Link and genome info: GL456367.1
Mus musculus unplaced genomic contig MSCHRUN_CTG2
GRCm39 reference primary assembly C57BL/6J

Nucleotide count: 36,043
'N' Nucleotide Count: 1,432
Atom	Atom Count	Percent	Variation %
Carbon	173,732	32.49	> ~0.2908
Hydrogen	191,805	35.87	> ~0.2813
Nitrogen	132,479	24.78	< ~0.6453
Oxygen	36,639	6.85	> ~0.0731
Totals	534,655	100.00	----

Promoter-Terminator Sections
Table: 5738 (Promoter Count: 27)
Link and genome info: NW_003315941.1
Homo sapiens chromosome 12 genomic scaffold
GRCh38.p14 alternate locus group ALT_REF_LOCI_1 HSCHR12_2_CTG2_1

Nucleotide count: 79,842
Atom	Atom Count	Percent	Variation %
Carbon	385,239	32.52	> ~0.3188
Hydrogen	425,513	35.92	> ~0.3290
Nitrogen	292,359	24.68	< ~0.7425
Oxygen	81,429	6.87	> ~0.0946
Totals	1,184,540	100.00	----

Promoter-Terminator Sections
Table: 5739 (Promoter Count: 53)
Link and genome info: KZ115449.1
Danio rerio chromosome 14 genomic contig ALT_CTG14_1_22
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 258,259
Atom	Atom Count	Percent	Variation %
Carbon	1,245,741	32.53	> ~0.3242
Hydrogen	1,376,903	35.95	> ~0.3592
Nitrogen	943,363	24.63	< ~0.7915
Oxygen	263,791	6.89	> ~0.1082
Totals	3,829,798	100.00	----

Promoter-Terminator Sections
Table: 5740 (Promoter Count: 5)
Link and genome info: KN150656.2
Danio rerio unplaced genomic contig NA989
GRCz11 reference primary assembly

Nucleotide count: 21,786
'N' Nucleotide Count: 100
Atom	Atom Count	Percent	Variation %
Carbon	104,881	32.50	> ~0.2984
Hydrogen	115,820	35.89	> ~0.2985
Nitrogen	80,162	24.84	< ~0.5821
Oxygen	21,830	6.76	< ~0.0148
Totals	322,693	100.00	----

Promoter-Terminator Sections
Table: 5741 (Promoter Count: 1)
Link and genome info: NKLS02002078.1
Bos taurus breed Hereford isolate L1 Dominette 01449 registration number 42190680 Leftover_ScbfJmS_872
whole genome shotgun sequence

Nucleotide count: 923
Atom	Atom Count	Percent	Variation %
Carbon	4,397	32.34	> ~0.1322
Hydrogen	4,885	35.92	> ~0.3312
Nitrogen	3,369	24.78	< ~0.6480
Oxygen	947	6.96	> ~0.1846
Totals	13,598	100.00	----

Promoter-Terminator Sections
Table: 5742 (Promoter Count: 9)
Link and genome info: NW_003335906.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA874

Nucleotide count: 55,099
'N' Nucleotide Count: 600
Atom	Atom Count	Percent	Variation %
Carbon	265,247	32.46	> ~0.2548
Hydrogen	293,283	35.89	> ~0.2958
Nitrogen	201,635	24.67	< ~0.7497
Oxygen	57,030	6.98	> ~0.1991
Totals	817,195	100.00	----

Promoter-Terminator Sections
Table: 5743 (Promoter Count: 85)
Link and genome info: KZ115692.1
Danio rerio chromosome 23 genomic contig ALT_CTG23_1_29
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 524,055
Atom	Atom Count	Percent	Variation %
Carbon	2,525,794	32.52	> ~0.3204
Hydrogen	2,788,434	35.91	> ~0.3125
Nitrogen	1,926,836	24.81	< ~0.6125
Oxygen	524,924	6.76	< ~0.0204
Totals	7,765,988	100.00	----

Promoter-Terminator Sections
Table: 5744 (Promoter Count: 4)
Link and genome info: NW_018394357.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA748

Nucleotide count: 3,975
'N' Nucleotide Count: 100
Atom	Atom Count	Percent	Variation %
Carbon	19,293	32.66	> ~0.4584
Hydrogen	21,145	35.80	> ~0.2039
Nitrogen	14,901	25.23	< ~0.1973
Oxygen	3,730	6.31	< ~0.4651
Totals	59,069	100.00	----

Promoter-Terminator Sections
Table: 5745 (Promoter Count: 81)
Link and genome info: KZ115317.1
Danio rerio chromosome 10 genomic contig ALT_CTG10_1_18
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 435,616
Atom	Atom Count	Percent	Variation %
Carbon	2,099,099	32.52	> ~0.3185
Hydrogen	2,316,353	35.89	> ~0.2946
Nitrogen	1,605,299	24.87	< ~0.5524
Oxygen	433,672	6.72	< ~0.0607
Totals	6,454,423	100.00	----

Promoter-Terminator Sections
Table: 5746 (Promoter Count: 5)
Link and genome info: NW_003336662.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA5

Nucleotide count: 16,463
Atom	Atom Count	Percent	Variation %
Carbon	78,992	32.45	> ~0.2439
Hydrogen	87,602	35.98	> ~0.3908
Nitrogen	59,808	24.57	< ~0.8565
Oxygen	17,045	7.00	> ~0.2218
Totals	243,447	100.00	----

Promoter-Terminator Sections
Table: 5747 (Promoter Count: 11)
Link and genome info: KI270934.1
Homo sapiens chromosome 3 genomic contig
GRCh38 reference assembly alternate locus group ALT_REF_LOCI_4

Nucleotide count: 82,466
Atom	Atom Count	Percent	Variation %
Carbon	391,694	32.23	> ~0.0236
Hydrogen	432,586	35.59	< ~0.0017
Nitrogen	310,290	25.53	> ~0.1057
Oxygen	80,850	6.65	< ~0.1277
Totals	1,215,420	100.00	----

Promoter-Terminator Sections
Table: 5748 (Promoter Count: 3)
Link and genome info: NW_003335691.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA23

Nucleotide count: 26,479
'N' Nucleotide Count: 1
Atom	Atom Count	Percent	Variation %
Carbon	127,347	32.50	> ~0.3012
Hydrogen	140,561	35.88	> ~0.2842
Nitrogen	97,801	24.96	< ~0.4606
Oxygen	26,073	6.65	< ~0.1247
Totals	391,782	100.00	----

Promoter-Terminator Sections
Table: 5749 (Promoter Count: 51)
Link and genome info: NW_018394569.1
Danio rerio strain Tuebingen chromosome 5 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG5_1_8

Nucleotide count: 365,561
Atom	Atom Count	Percent	Variation %
Carbon	1,763,990	32.55	> ~0.3425
Hydrogen	1,945,617	35.90	> ~0.3038
Nitrogen	1,346,739	24.85	< ~0.5761
Oxygen	363,655	6.71	< ~0.0702
Totals	5,420,001	100.00	----

Promoter-Terminator Sections
Table: 5750 (Promoter Count: 38)
Link and genome info: KZ115229.1
Danio rerio chromosome 7 genomic contig ALT_CTG7_1_22
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 236,440
Atom	Atom Count	Percent	Variation %
Carbon	1,140,961	32.55	> ~0.3449
Hydrogen	1,260,286	35.95	> ~0.3591
Nitrogen	865,464	24.69	< ~0.7346
Oxygen	238,733	6.81	> ~0.0306
Totals	3,505,444	100.00	----

Promoter-Terminator Sections
Table: 5751 (Promoter Count: 55)
Link and genome info: NW_013171802.1
Homo sapiens chromosome 6 genomic patch of type FIX
GRCh38.p14 PATCHES HG2072_PATCH

Nucleotide count: 156,525
Atom	Atom Count	Percent	Variation %
Carbon	752,839	32.49	> ~0.2914
Hydrogen	829,910	35.82	> ~0.2283
Nitrogen	581,198	25.09	< ~0.3374
Oxygen	152,849	6.60	< ~0.1823
Totals	2,316,796	100.00	----

Promoter-Terminator Sections
Table: 5752 (Promoter Count: 3)
Link and genome info: KN148869.2
Danio rerio unplaced genomic contig NA809
GRCz11 reference primary assembly

Nucleotide count: 12,756
Atom	Atom Count	Percent	Variation %
Carbon	61,496	32.49	> ~0.2864
Hydrogen	67,723	35.78	> ~0.1864
Nitrogen	47,383	25.03	< ~0.3902
Oxygen	12,676	6.70	< ~0.0827
Totals	189,278	100.00	----

Promoter-Terminator Sections
Table: 5753 (Promoter Count: 3)
Link and genome info: NW_003336646.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA333

Nucleotide count: 14,193
Atom	Atom Count	Percent	Variation %
Carbon	68,527	32.53	> ~0.3236
Hydrogen	75,522	35.85	> ~0.2541
Nitrogen	52,418	24.88	< ~0.5430
Oxygen	14,210	6.74	< ~0.0348
Totals	210,677	100.00	----

Promoter-Terminator Sections
Table: 5754 (Promoter Count: 2)
Link and genome info: NW_003336433.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA1047

Nucleotide count: 15,523
'N' Nucleotide Count: 100
Atom	Atom Count	Percent	Variation %
Carbon	74,866	32.52	> ~0.3213
Hydrogen	82,587	35.88	> ~0.2858
Nitrogen	57,201	24.85	< ~0.5734
Oxygen	15,528	6.75	< ~0.0337
Totals	230,182	100.00	----

Promoter-Terminator Sections
Table: 5755 (Promoter Count: 15)
Link and genome info: KZ116066.1
Danio rerio unplaced genomic contig CTG20006
GRCz11 reference primary assembly

Nucleotide count: 105,666
Atom	Atom Count	Percent	Variation %
Carbon	509,011	32.47	> ~0.2667
Hydrogen	560,173	35.73	> ~0.1406
Nitrogen	394,163	25.14	< ~0.2798
Oxygen	104,283	6.65	< ~0.1274
Totals	1,567,630	100.00	----

Promoter-Terminator Sections
Table: 5756 (Promoter Count: 16)
Link and genome info: ML143361.1
Homo sapiens chromosome 12 genomic contig HG2246_HG2248_HG2276_PATCH
GRC reference assembly FIX PATCH for GRCh38

Nucleotide count: 163,638
Atom	Atom Count	Percent	Variation %
Carbon	770,175	32.06	< ~0.1415
Hydrogen	853,508	35.53	< ~0.0622
Nitrogen	616,206	25.65	> ~0.2286
Oxygen	162,258	6.75	< ~0.0250
Totals	2,402,147	100.00	----

Promoter-Terminator Sections
Table: 5757 (Promoter Count: 310)
Link and genome info: NC_000067.7
Mus musculus strain C57BL/6J chromosome 1
GRCm39

Nucleotide count: 952,798
Atom	Atom Count	Percent	Variation %
Carbon	4,580,427	32.47	> ~0.2646
Hydrogen	5,051,446	35.81	> ~0.2136
Nitrogen	3,534,496	25.05	< ~0.3697
Oxygen	941,149	6.67	< ~0.1084
Totals	14,107,518	100.00	----

Promoter-Terminator Sections
Table: 5758 (Promoter Count: 23)
Link and genome info: NW_018395160.1
Danio rerio strain Tuebingen chromosome 23 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG23_1_34

Nucleotide count: 190,233
Atom	Atom Count	Percent	Variation %
Carbon	916,298	32.53	> ~0.3275
Hydrogen	1,010,973	35.89	> ~0.2989
Nitrogen	702,007	24.92	< ~0.5007
Oxygen	187,424	6.65	< ~0.1257
Totals	2,816,702	100.00	----

Promoter-Terminator Sections
Table: 5759 (Promoter Count: 74)
Link and genome info: KZ115418.1
Danio rerio chromosome 13 genomic contig ALT_CTG13_1_22
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 321,665
Atom	Atom Count	Percent	Variation %
Carbon	1,551,913	32.53	> ~0.3296
Hydrogen	1,712,403	35.90	> ~0.3042
Nitrogen	1,183,267	24.81	< ~0.6186
Oxygen	322,683	6.76	< ~0.0152
Totals	4,770,266	100.00	----

Promoter-Terminator Sections
Table: 5760 (Promoter Count: 31)
Link and genome info: NT_167219.1
Homo sapiens chromosome 14 unlocalized genomic scaffold
GRCh38.p14 Primary Assembly HSCHR14_CTG2_UNLOCALIZED

Nucleotide count: 56,799
Atom	Atom Count	Percent	Variation %
Carbon	271,478	32.33	> ~0.1243
Hydrogen	298,381	35.53	< ~0.0618
Nitrogen	215,803	25.70	> ~0.2742
Oxygen	54,106	6.44	< ~0.3367
Totals	839,768	100.00	----

Promoter-Terminator Sections
Table: 5761 (Promoter Count: 6)
Link and genome info: KZ116024.1
Danio rerio unplaced genomic contig NA705
GRCz11 reference primary assembly

Nucleotide count: 6,981
Atom	Atom Count	Percent	Variation %
Carbon	33,506	32.44	> ~0.2360
Hydrogen	37,149	35.97	> ~0.3732
Nitrogen	25,375	24.57	< ~0.8565
Oxygen	7,258	7.03	> ~0.2473
Totals	103,288	100.00	----

Promoter-Terminator Sections
Table: 5762 (Promoter Count: 37)
Link and genome info: NW_018394895.1
Danio rerio strain Tuebingen chromosome 14 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG14_1_5

Nucleotide count: 199,968
Atom	Atom Count	Percent	Variation %
Carbon	962,412	32.49	> ~0.2890
Hydrogen	1,061,717	35.85	> ~0.2519
Nitrogen	739,353	24.96	< ~0.4621
Oxygen	198,480	6.70	< ~0.0787
Totals	2,961,962	100.00	----

Promoter-Terminator Sections
Table: 5763 (Promoter Count: 15)
Link and genome info: NT_187682.1
Homo sapiens chromosome 22 genomic scaffold
GRCh38.p14 alternate locus group ALT_REF_LOCI_3 HSCHR22_3_CTG1

Nucleotide count: 124,152
Atom	Atom Count	Percent	Variation %
Carbon	590,910	32.26	> ~0.0539
Hydrogen	651,998	35.59	< ~0.0011
Nitrogen	467,346	25.51	> ~0.0884
Oxygen	121,608	6.64	< ~0.1412
Totals	1,831,862	100.00	----

Promoter-Terminator Sections
Table: 5764 (Promoter Count: 3)
Link and genome info: NW_020190263.1
Bos taurus isolate L1 Dominette 01449 registration number 42190680 breed Hereford unplaced genomic scaffold
ARS-UCD2.0 Leftover_ScbfJmS_1153, whole genome shotgun sequence

Nucleotide count: 20,075
Atom	Atom Count	Percent	Variation %
Carbon	96,636	32.41	> ~0.2051
Hydrogen	106,278	35.64	> ~0.0489
Nitrogen	75,188	25.22	< ~0.2081
Oxygen	20,079	6.73	< ~0.0459
Totals	298,181	100.00	----

Promoter-Terminator Sections
Table: 5765 (Promoter Count: 3)
Link and genome info: KI270836.1
Homo sapiens chromosome 12 genomic contig
GRCh38 reference assembly alternate locus group ALT_REF_LOCI_1

Nucleotide count: 37,116
Atom	Atom Count	Percent	Variation %
Carbon	176,397	32.13	< ~0.0713
Hydrogen	193,876	35.32	< ~0.2771
Nitrogen	142,326	25.93	> ~0.5021
Oxygen	36,375	6.63	< ~0.1537
Totals	548,974	100.00	----

Promoter-Terminator Sections
Table: 5766 (Promoter Count: 1)
Link and genome info: KN150536.1
Danio rerio unplaced genomic contig NA880
GRCz11 reference primary assembly

Nucleotide count: 10,054
Atom	Atom Count	Percent	Variation %
Carbon	48,444	32.54	> ~0.3318
Hydrogen	53,433	35.89	> ~0.2927
Nitrogen	37,129	24.94	< ~0.4877
Oxygen	9,891	6.64	< ~0.1369
Totals	148,897	100.00	----

Promoter-Terminator Sections
Table: 5767 (Promoter Count: 35)
Link and genome info: NT_187633.1
Homo sapiens chromosome 22 genomic scaffold
GRCh38.p14 alternate locus group ALT_REF_LOCI_1 HSCHR22_1_CTG7

Nucleotide count: 124,825
Atom	Atom Count	Percent	Variation %
Carbon	592,622	32.19	< ~0.0105
Hydrogen	655,918	35.63	> ~0.0381
Nitrogen	465,740	25.30	< ~0.1234
Oxygen	126,569	6.88	> ~0.0959
Totals	1,840,849	100.00	----

Promoter-Terminator Sections
Table: 5768 (Promoter Count: 167)
Link and genome info: KI270803.1
Homo sapiens chromosome 7 genomic contig
GRCh38 reference assembly alternate locus group ALT_REF_LOCI_1

Nucleotide count: 577,818
Atom	Atom Count	Percent	Variation %
Carbon	2,769,353	32.39	> ~0.1910
Hydrogen	3,056,717	35.76	> ~0.1627
Nitrogen	2,146,735	25.11	< ~0.3123
Oxygen	576,050	6.74	< ~0.0414
Totals	8,548,855	100.00	----

Promoter-Terminator Sections
Table: 5769 (Promoter Count: 2)
Link and genome info: NW_003336361.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA745

Nucleotide count: 4,532
Atom	Atom Count	Percent	Variation %
Carbon	21,901	32.57	> ~0.3660
Hydrogen	24,088	35.82	> ~0.2286
Nitrogen	16,858	25.07	< ~0.3538
Oxygen	4,397	6.54	< ~0.2408
Totals	67,244	100.00	----

Promoter-Terminator Sections
Table: 5770 (Promoter Count: 14)
Link and genome info: KN150605.1
Danio rerio unplaced genomic contig NA939
GRCz11 reference primary assembly

Nucleotide count: 67,118
'N' Nucleotide Count: 200
Atom	Atom Count	Percent	Variation %
Carbon	322,150	32.44	> ~0.2368
Hydrogen	354,934	35.74	> ~0.1483
Nitrogen	250,678	25.24	< ~0.1807
Oxygen	65,296	6.58	< ~0.2045
Totals	993,058	100.00	----

Promoter-Terminator Sections
Table: 5771 (Promoter Count: 79)
Link and genome info: KZ114977.1
Danio rerio chromosome 22 genomic contig ALT_CTG22_2_3
GRCz11 reference assembly alternate locus group ALT_DRER_TU_2

Nucleotide count: 458,061
Atom	Atom Count	Percent	Variation %
Carbon	2,208,995	32.53	> ~0.3267
Hydrogen	2,438,748	35.91	> ~0.3203
Nitrogen	1,682,356	24.77	< ~0.6490
Oxygen	460,522	6.78	> ~0.0020
Totals	6,790,621	100.00	----

Promoter-Terminator Sections
Table: 5772 (Promoter Count: 3)
Link and genome info: KN150310.1
Danio rerio unplaced genomic contig NA667
GRCz11 reference primary assembly

Nucleotide count: 13,793
Atom	Atom Count	Percent	Variation %
Carbon	66,562	32.53	> ~0.3306
Hydrogen	73,247	35.80	> ~0.2083
Nitrogen	51,313	25.08	< ~0.3431
Oxygen	13,470	6.58	< ~0.1959
Totals	204,592	100.00	----

Promoter-Terminator Sections
Table: 5773 (Promoter Count: 39)
Link and genome info: KZ115224.1
Danio rerio chromosome 7 genomic contig ALT_CTG7_1_17
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 251,329
Atom	Atom Count	Percent	Variation %
Carbon	1,212,363	32.52	> ~0.3211
Hydrogen	1,338,822	35.92	> ~0.3239
Nitrogen	921,550	24.72	< ~0.7009
Oxygen	254,802	6.84	> ~0.0560
Totals	3,727,537	100.00	----

Promoter-Terminator Sections
Table: 5774 (Promoter Count: 26)
Link and genome info: KZ115598.1
Danio rerio chromosome 20 genomic contig ALT_CTG20_1_2
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 160,326
Atom	Atom Count	Percent	Variation %
Carbon	772,636	32.52	> ~0.3127
Hydrogen	853,130	35.90	> ~0.3104
Nitrogen	589,142	24.79	< ~0.6299
Oxygen	161,259	6.79	> ~0.0068
Totals	2,376,167	100.00	----

Promoter-Terminator Sections
Table: 5775 (Promoter Count: 31)
Link and genome info: KZ559109.1
Homo sapiens chromosome 11 genomic contig HG2114_PATCH
GRC reference assembly FIX PATCH for GRCh38

Nucleotide count: 203,874
Atom	Atom Count	Percent	Variation %
Carbon	973,686	32.33	> ~0.1243
Hydrogen	1,074,120	35.66	> ~0.0691
Nitrogen	763,752	25.36	< ~0.0661
Oxygen	200,364	6.65	< ~0.1273
Totals	3,011,922	100.00	----

Promoter-Terminator Sections
Table: 5776 (Promoter Count: 9)
Link and genome info: NW_020191845.1
Bos taurus isolate L1 Dominette 01449 registration number 42190680 breed Hereford unplaced genomic scaffold
ARS-UCD2.0 Leftover_ScbfJmS_542, whole genome shotgun sequence

Nucleotide count: 33,156
Atom	Atom Count	Percent	Variation %
Carbon	159,066	32.40	> ~0.1978
Hydrogen	174,687	35.58	< ~0.0101
Nitrogen	125,631	25.59	> ~0.1669
Oxygen	31,543	6.43	< ~0.3545
Totals	490,927	100.00	----

Promoter-Terminator Sections
Table: 5777 (Promoter Count: 49)
Link and genome info: KZ115416.1
Danio rerio chromosome 13 genomic contig ALT_CTG13_1_20
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 298,746
Atom	Atom Count	Percent	Variation %
Carbon	1,438,914	32.50	> ~0.2935
Hydrogen	1,588,558	35.88	> ~0.2833
Nitrogen	1,099,614	24.83	< ~0.5896
Oxygen	300,761	6.79	> ~0.0128
Totals	4,427,847	100.00	----

Promoter-Terminator Sections
Table: 5778 (Promoter Count: 43)
Link and genome info: NW_018394721.1
Danio rerio strain Tuebingen chromosome 8 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG8_1_6

Nucleotide count: 302,399
Atom	Atom Count	Percent	Variation %
Carbon	1,457,959	32.53	> ~0.3226
Hydrogen	1,609,561	35.91	> ~0.3149
Nitrogen	1,111,225	24.79	< ~0.6331
Oxygen	303,695	6.78	< ~0.0045
Totals	4,482,440	100.00	----

Promoter-Terminator Sections
Table: 5779 (Promoter Count: 2)
Link and genome info: KN150199.1
Danio rerio unplaced genomic contig NA561
GRCz11 reference primary assembly

Nucleotide count: 13,171
Atom	Atom Count	Percent	Variation %
Carbon	63,335	32.47	> ~0.2708
Hydrogen	69,965	35.87	> ~0.2804
Nitrogen	48,485	24.86	< ~0.5637
Oxygen	13,247	6.79	> ~0.0125
Totals	195,032	100.00	----

Promoter-Terminator Sections
Table: 5780 (Promoter Count: 2)
Link and genome info: KN149728.1
Danio rerio unplaced genomic contig NA117
GRCz11 reference primary assembly

Nucleotide count: 7,794
Atom	Atom Count	Percent	Variation %
Carbon	37,564	32.50	> ~0.2987
Hydrogen	41,337	35.77	> ~0.1735
Nitrogen	29,057	25.14	< ~0.2822
Oxygen	7,616	6.59	< ~0.1900
Totals	115,574	100.00	----

Promoter-Terminator Sections
Table: 5781 (Promoter Count: 2)
Link and genome info: NW_003337250.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA537

Nucleotide count: 6,144
Atom	Atom Count	Percent	Variation %
Carbon	29,640	32.49	> ~0.2880
Hydrogen	32,737	35.89	> ~0.2932
Nitrogen	22,509	24.67	< ~0.7493
Oxygen	6,338	6.95	> ~0.1680
Totals	91,224	100.00	----

Promoter-Terminator Sections
Table: 5782 (Promoter Count: 39)
Link and genome info: NW_018394687.1
Danio rerio strain Tuebingen chromosome 7 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG7_1_17

Nucleotide count: 251,329
Atom	Atom Count	Percent	Variation %
Carbon	1,212,363	32.52	> ~0.3211
Hydrogen	1,338,822	35.92	> ~0.3239
Nitrogen	921,550	24.72	< ~0.7009
Oxygen	254,802	6.84	> ~0.0560
Totals	3,727,537	100.00	----

Promoter-Terminator Sections
Table: 5783 (Promoter Count: 3)
Link and genome info: NW_020190531.1
Bos taurus isolate L1 Dominette 01449 registration number 42190680 breed Hereford unplaced genomic scaffold
ARS-UCD2.0 Leftover_ScbfJmS_143, whole genome shotgun sequence

Nucleotide count: 12,984
Atom	Atom Count	Percent	Variation %
Carbon	62,033	32.38	> ~0.1802
Hydrogen	68,084	35.54	< ~0.0508
Nitrogen	49,654	25.92	> ~0.4976
Oxygen	11,786	6.15	< ~0.6270
Totals	191,557	100.00	----

Promoter-Terminator Sections
Table: 5784 (Promoter Count: 7)
Link and genome info: NW_008805579.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA1007

Nucleotide count: 47,567
'N' Nucleotide Count: 100
Atom	Atom Count	Percent	Variation %
Carbon	227,798	32.37	> ~0.1640
Hydrogen	251,172	35.69	> ~0.0953
Nitrogen	177,750	25.26	< ~0.1676
Oxygen	47,069	6.69	< ~0.0918
Totals	703,789	100.00	----

Promoter-Terminator Sections
Table: 5785 (Promoter Count: 21)
Link and genome info: NW_018395244.1
Danio rerio strain Tuebingen chromosome 5 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_2 ALT_CTG5_2_11

Nucleotide count: 146,844
Atom	Atom Count	Percent	Variation %
Carbon	707,880	32.52	> ~0.3215
Hydrogen	781,122	35.89	> ~0.2970
Nitrogen	540,834	24.85	< ~0.5740
Oxygen	146,586	6.74	< ~0.0445
Totals	2,176,422	100.00	----

Promoter-Terminator Sections
Table: 5786 (Promoter Count: 17)
Link and genome info: KI270846.1
Homo sapiens chromosome 14 genomic contig
GRCh38 reference assembly alternate locus group ALT_REF_LOCI_1

Nucleotide count: 224,037
Atom	Atom Count	Percent	Variation %
Carbon	1,059,068	32.07	< ~0.1287
Hydrogen	1,172,399	35.51	< ~0.0862
Nitrogen	841,309	25.48	> ~0.0560
Oxygen	229,101	6.94	> ~0.1588
Totals	3,301,877	100.00	----

Promoter-Terminator Sections
Table: 5787 (Promoter Count: 4)
Link and genome info: NW_003336299.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA480

Nucleotide count: 37,803
'N' Nucleotide Count: 500
Atom	Atom Count	Percent	Variation %
Carbon	181,957	32.52	> ~0.3126
Hydrogen	200,214	35.78	> ~0.1853
Nitrogen	141,302	25.25	< ~0.1728
Oxygen	36,120	6.45	< ~0.3250
Totals	559,593	100.00	----

Promoter-Terminator Sections
Table: 5788 (Promoter Count: 2)
Link and genome info: KN150690.1
Danio rerio unplaced genomic contig NA98
GRCz11 reference primary assembly

Nucleotide count: 6,532
Atom	Atom Count	Percent	Variation %
Carbon	31,606	32.49	> ~0.2833
Hydrogen	34,625	35.59	< ~0.0034
Nitrogen	24,657	25.34	< ~0.0796
Oxygen	6,401	6.58	< ~0.2003
Totals	97,289	100.00	----

Promoter-Terminator Sections
Table: 5789 (Promoter Count: 20)
Link and genome info: NW_018395275.1
Danio rerio strain Tuebingen chromosome 8 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_2 ALT_CTG8_2_6

Nucleotide count: 108,128
Atom	Atom Count	Percent	Variation %
Carbon	520,901	32.52	> ~0.3207
Hydrogen	574,805	35.89	> ~0.2966
Nitrogen	398,667	24.89	< ~0.5316
Oxygen	107,210	6.69	< ~0.0857
Totals	1,601,583	100.00	----

Promoter-Terminator Sections
Table: 5790 (Promoter Count: 1)
Link and genome info: KN150439.1
Danio rerio unplaced genomic contig NA790
GRCz11 reference primary assembly

Nucleotide count: 9,600
'N' Nucleotide Count: 100
Atom	Atom Count	Percent	Variation %
Carbon	46,399	32.56	> ~0.3575
Hydrogen	51,222	35.95	> ~0.3523
Nitrogen	35,132	24.65	< ~0.7695
Oxygen	9,746	6.84	> ~0.0596
Totals	142,499	100.00	----

Promoter-Terminator Sections
Table: 5791 (Promoter Count: 4)
Link and genome info: NW_020190989.1
Bos taurus isolate L1 Dominette 01449 registration number 42190680 breed Hereford unplaced genomic scaffold
ARS-UCD2.0 Leftover_ScbfJmS_1894, whole genome shotgun sequence

Nucleotide count: 12,601
Atom	Atom Count	Percent	Variation %
Carbon	60,821	32.54	> ~0.3370
Hydrogen	66,991	35.84	> ~0.2483
Nitrogen	46,679	24.97	< ~0.4495
Oxygen	12,418	6.64	< ~0.1358
Totals	186,909	100.00	----

Promoter-Terminator Sections
Table: 5792 (Promoter Count: 1)
Link and genome info: KN150280.1
Danio rerio unplaced genomic contig NA63
GRCz11 reference primary assembly

Nucleotide count: 2,738
Atom	Atom Count	Percent	Variation %
Carbon	13,279	32.65	> ~0.4512
Hydrogen	14,626	35.97	> ~0.3738
Nitrogen	10,060	24.74	< ~0.6850
Oxygen	2,700	6.64	< ~0.1401
Totals	40,665	100.00	----

Promoter-Terminator Sections
Table: 5793 (Promoter Count: 3)
Link and genome info: KN149745.1
Danio rerio unplaced genomic contig NA133
GRCz11 reference primary assembly

Nucleotide count: 626
Atom	Atom Count	Percent	Variation %
Carbon	2,967	32.36	> ~0.1556
Hydrogen	3,266	35.62	> ~0.0268
Nitrogen	2,396	26.13	> ~0.7078
Oxygen	540	5.89	< ~0.8903
Totals	9,169	100.00	----

Promoter-Terminator Sections
Table: 5794 (Promoter Count: 43)
Link and genome info: KZ115722.1
Danio rerio chromosome 24 genomic contig ALT_CTG24_1_22
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 266,229
Atom	Atom Count	Percent	Variation %
Carbon	1,282,239	32.52	> ~0.3169
Hydrogen	1,416,305	35.92	> ~0.3274
Nitrogen	977,853	24.80	< ~0.6232
Oxygen	266,485	6.76	< ~0.0211
Totals	3,942,882	100.00	----

Promoter-Terminator Sections
Table: 5795 (Promoter Count: 17)
Link and genome info: NW_018395243.1
Danio rerio strain Tuebingen chromosome 5 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_2 ALT_CTG5_2_10

Nucleotide count: 140,928
Atom	Atom Count	Percent	Variation %
Carbon	680,748	32.57	> ~0.3621
Hydrogen	751,398	35.95	> ~0.3520
Nitrogen	516,582	24.71	< ~0.7116
Oxygen	141,669	6.78	< ~0.0026
Totals	2,090,397	100.00	----

Promoter-Terminator Sections
Table: 5796 (Promoter Count: 196)
Link and genome info: CM000998.3
Mus musculus chromosome 5
GRCm39 reference primary assembly C57BL/6J

Nucleotide count: 801,097
Atom	Atom Count	Percent	Variation %
Carbon	3,843,359	32.41	> ~0.2093
Hydrogen	4,244,687	35.80	> ~0.2041
Nitrogen	2,963,627	24.99	< ~0.4301
Oxygen	805,885	6.80	> ~0.0167
Totals	11,857,558	100.00	----

Promoter-Terminator Sections
Table: 5797 (Promoter Count: 35)
Link and genome info: NW_018394806.1
Danio rerio strain Tuebingen chromosome 11 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG11_1_6

Nucleotide count: 265,006
Atom	Atom Count	Percent	Variation %
Carbon	1,275,632	32.50	> ~0.2977
Hydrogen	1,410,248	35.93	> ~0.3377
Nitrogen	970,580	24.73	< ~0.6948
Oxygen	268,426	6.84	> ~0.0594
Totals	3,924,886	100.00	----

Promoter-Terminator Sections
Table: 5798 (Promoter Count: 2)
Link and genome info: NW_008805470.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA60

Nucleotide count: 7,600
Atom	Atom Count	Percent	Variation %
Carbon	36,622	32.50	> ~0.3009
Hydrogen	40,226	35.70	> ~0.1099
Nitrogen	28,566	25.35	< ~0.0696
Oxygen	7,254	6.44	< ~0.3413
Totals	112,668	100.00	----

Promoter-Terminator Sections
Table: 5799 (Promoter Count: 27)
Link and genome info: KZ115474.1
Danio rerio chromosome 15 genomic contig ALT_CTG15_1_6
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 169,343
Atom	Atom Count	Percent	Variation %
Carbon	815,565	32.52	> ~0.3143
Hydrogen	899,058	35.85	> ~0.2535
Nitrogen	627,386	25.01	< ~0.4089
Oxygen	166,055	6.62	< ~0.1589
Totals	2,508,064	100.00	----

Promoter-Terminator Sections
Table: 5800 (Promoter Count: 2)
Link and genome info: NW_003336635.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA19

Nucleotide count: 4,523
'N' Nucleotide Count: 100
Atom	Atom Count	Percent	Variation %
Carbon	21,887	32.64	> ~0.4365
Hydrogen	24,158	36.03	> ~0.4334
Nitrogen	16,530	24.65	< ~0.7727
Oxygen	4,481	6.68	< ~0.0972
Totals	67,056	100.00	----

Promoter-Terminator Sections
Table: 5801 (Promoter Count: 52)
Link and genome info: NW_018395062.1
Danio rerio strain Tuebingen chromosome 20 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG20_1_3

Nucleotide count: 306,338
Atom	Atom Count	Percent	Variation %
Carbon	1,476,729	32.52	> ~0.3170
Hydrogen	1,627,563	35.84	> ~0.2488
Nitrogen	1,134,149	24.98	< ~0.4476
Oxygen	302,497	6.66	< ~0.1181
Totals	4,540,938	100.00	----

Promoter-Terminator Sections
Table: 5802 (Promoter Count: 4)
Link and genome info: NW_020190764.1
Bos taurus isolate L1 Dominette 01449 registration number 42190680 breed Hereford unplaced genomic scaffold
ARS-UCD2.0 Leftover_ScbfJmS_1664, whole genome shotgun sequence

Nucleotide count: 6,608
Atom	Atom Count	Percent	Variation %
Carbon	31,867	32.50	> ~0.2984
Hydrogen	35,168	35.87	> ~0.2753
Nitrogen	24,310	24.79	< ~0.6295
Oxygen	6,702	6.84	> ~0.0558
Totals	98,047	100.00	----

Promoter-Terminator Sections
Table: 5803 (Promoter Count: 5)
Link and genome info: NW_025791783.1
Homo sapiens chromosome 8 genomic patch of type FIX
GRCh38.p14 PATCHES HG1047_PATCH

Nucleotide count: 13,691
Atom	Atom Count	Percent	Variation %
Carbon	65,246	32.32	> ~0.1190
Hydrogen	72,584	35.96	> ~0.3644
Nitrogen	49,650	24.60	< ~0.8274
Oxygen	14,380	7.12	> ~0.3440
Totals	201,860	100.00	----

Promoter-Terminator Sections
Table: 5804 (Promoter Count: 7)
Link and genome info: NT_187515.1
Homo sapiens chromosome 1 genomic scaffold
GRCh38.p14 alternate locus group ALT_REF_LOCI_1 HSCHR1_1_CTG3

Nucleotide count: 82,920
Atom	Atom Count	Percent	Variation %
Carbon	390,420	32.00	< ~0.2077
Hydrogen	431,256	35.34	< ~0.2509
Nitrogen	316,272	25.92	> ~0.4955
Oxygen	82,277	6.74	< ~0.0369
Totals	1,220,225	100.00	----

Promoter-Terminator Sections
Table: 5805 (Promoter Count: 1)
Link and genome info: NW_003337129.2
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA393

Nucleotide count: 5,010
Atom	Atom Count	Percent	Variation %
Carbon	24,057	32.45	> ~0.2499
Hydrogen	26,602	35.89	> ~0.2934
Nitrogen	18,408	24.83	< ~0.5910
Oxygen	5,061	6.83	> ~0.0477
Totals	74,128	100.00	----

Promoter-Terminator Sections
Table: 5806 (Promoter Count: 216)
Link and genome info: NC_000084.7
Mus musculus strain C57BL/6J chromosome 18
GRCm39

Nucleotide count: 673,828
Atom	Atom Count	Percent	Variation %
Carbon	3,233,729	32.42	> ~0.2154
Hydrogen	3,570,181	35.79	> ~0.1986
Nitrogen	2,495,195	25.01	< ~0.4089
Oxygen	675,761	6.77	< ~0.0051
Totals	9,974,866	100.00	----

Promoter-Terminator Sections
Table: 5807 (Promoter Count: 34)
Link and genome info: KZ114932.1
Danio rerio chromosome 13 genomic contig ALT_CTG13_2_3
GRCz11 reference assembly alternate locus group ALT_DRER_TU_2

Nucleotide count: 227,339
Atom	Atom Count	Percent	Variation %
Carbon	1,095,204	32.51	> ~0.3088
Hydrogen	1,209,449	35.90	> ~0.3104
Nitrogen	835,451	24.80	< ~0.6226
Oxygen	228,495	6.78	> ~0.0034
Totals	3,368,599	100.00	----

Promoter-Terminator Sections
Table: 5808 (Promoter Count: 3)
Link and genome info: KN149706.1
Danio rerio unplaced genomic contig NA1045
GRCz11 reference primary assembly

Nucleotide count: 21,554
'N' Nucleotide Count: 300
Atom	Atom Count	Percent	Variation %
Carbon	103,529	32.52	> ~0.3167
Hydrogen	114,316	35.91	> ~0.3153
Nitrogen	79,650	25.02	< ~0.4044
Oxygen	20,859	6.55	< ~0.2276
Totals	318,354	100.00	----

Promoter-Terminator Sections
Table: 5809 (Promoter Count: 6)
Link and genome info: NW_003337093.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA366

Nucleotide count: 40,649
Atom	Atom Count	Percent	Variation %
Carbon	195,952	32.50	> ~0.2984
Hydrogen	215,956	35.82	> ~0.2266
Nitrogen	150,526	24.97	< ~0.4565
Oxygen	40,461	6.71	< ~0.0686
Totals	602,895	100.00	----

Promoter-Terminator Sections
Table: 5810 (Promoter Count: 41)
Link and genome info: KZ115291.1
Danio rerio chromosome 9 genomic contig ALT_CTG9_1_12
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 239,826
Atom	Atom Count	Percent	Variation %
Carbon	1,156,474	32.53	> ~0.3252
Hydrogen	1,277,316	35.93	> ~0.3344
Nitrogen	879,260	24.73	< ~0.6924
Oxygen	242,201	6.81	> ~0.0328
Totals	3,555,251	100.00	----

Promoter-Terminator Sections
Table: 5811 (Promoter Count: 70)
Link and genome info: NW_021160013.1
Homo sapiens chromosome 14 genomic patch of type FIX
GRCh38.p14 PATCHES HG2510_PATCH

Nucleotide count: 274,711
Atom	Atom Count	Percent	Variation %
Carbon	1,317,303	32.40	> ~0.1975
Hydrogen	1,452,131	35.72	> ~0.1240
Nitrogen	1,025,323	25.22	< ~0.2044
Oxygen	270,879	6.66	< ~0.1171
Totals	4,065,636	100.00	----

Promoter-Terminator Sections
Table: 5812 (Promoter Count: 2)
Link and genome info: NKLS02000977.1
Bos taurus breed Hereford isolate L1 Dominette 01449 registration number 42190680 Leftover_ScbfJmS_1969
whole genome shotgun sequence

Nucleotide count: 1,098
Atom	Atom Count	Percent	Variation %
Carbon	5,281	32.47	> ~0.2651
Hydrogen	5,820	35.78	> ~0.1892
Nitrogen	4,082	25.10	< ~0.3269
Oxygen	1,082	6.65	< ~0.1274
Totals	16,265	100.00	----

Promoter-Terminator Sections
Table: 5813 (Promoter Count: 1)
Link and genome info: KI270833.1
Homo sapiens chromosome 12 genomic contig
GRCh38 reference assembly alternate locus group ALT_REF_LOCI_1

Nucleotide count: 3,106
Atom	Atom Count	Percent	Variation %
Carbon	14,971	32.55	> ~0.3472
Hydrogen	16,691	36.29	> ~0.6971
Nitrogen	10,929	23.76	< ~1.6614
Oxygen	3,402	7.40	> ~0.6171
Totals	45,993	100.00	----

Promoter-Terminator Sections
Table: 5814 (Promoter Count: 28)
Link and genome info: KZ115576.1
Danio rerio chromosome 18 genomic contig ALT_CTG18_1_39
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 182,242
Atom	Atom Count	Percent	Variation %
Carbon	879,427	32.54	> ~0.3371
Hydrogen	970,988	35.93	> ~0.3352
Nitrogen	668,310	24.73	< ~0.6950
Oxygen	183,840	6.80	> ~0.0227
Totals	2,702,565	100.00	----

Promoter-Terminator Sections
Table: 5815 (Promoter Count: 18)
Link and genome info: KI270852.1
Homo sapiens chromosome 15 genomic contig
GRCh38 reference assembly alternate locus group ALT_REF_LOCI_1

Nucleotide count: 61,872
Atom	Atom Count	Percent	Variation %
Carbon	297,406	32.50	> ~0.2953
Hydrogen	328,073	35.85	> ~0.2566
Nitrogen	229,313	25.06	< ~0.3658
Oxygen	60,340	6.59	< ~0.1861
Totals	915,132	100.00	----

Promoter-Terminator Sections
Table: 5816 (Promoter Count: 24)
Link and genome info: NKLS02000244.1
Bos taurus breed Hereford isolate L1 Dominette 01449 registration number 42190680 Leftover_ScbfJmS_1223
whole genome shotgun sequence

Nucleotide count: 95,442
Atom	Atom Count	Percent	Variation %
Carbon	458,550	32.42	> ~0.2216
Hydrogen	506,728	35.83	> ~0.2385
Nitrogen	351,336	24.84	< ~0.5800
Oxygen	97,574	6.90	> ~0.1199
Totals	1,414,188	100.00	----

Promoter-Terminator Sections
Table: 5817 (Promoter Count: 2)
Link and genome info: KN149705.1
Danio rerio unplaced genomic contig NA1044
GRCz11 reference primary assembly

Nucleotide count: 22,392
'N' Nucleotide Count: 200
Atom	Atom Count	Percent	Variation %
Carbon	107,751	32.50	> ~0.2983
Hydrogen	118,784	35.83	> ~0.2365
Nitrogen	83,070	25.06	< ~0.3667
Oxygen	21,919	6.61	< ~0.1681
Totals	331,524	100.00	----

Promoter-Terminator Sections
Table: 5818 (Promoter Count: 3)
Link and genome info: NT_187620.1
Homo sapiens chromosome 19 genomic scaffold
GRCh38.p14 alternate locus group ALT_REF_LOCI_1 HSCHR19_3_CTG3_1

Nucleotide count: 11,766
Atom	Atom Count	Percent	Variation %
Carbon	56,364	32.44	> ~0.2367
Hydrogen	62,552	36.00	> ~0.4084
Nitrogen	42,732	24.59	< ~0.8295
Oxygen	12,100	6.96	> ~0.1844
Totals	173,748	100.00	----

Promoter-Terminator Sections
Table: 5819 (Promoter Count: 7)
Link and genome info: KN150022.1
Danio rerio unplaced genomic contig NA396
GRCz11 reference primary assembly

Nucleotide count: 53,201
'N' Nucleotide Count: 314
Atom	Atom Count	Percent	Variation %
Carbon	256,925	32.50	> ~0.2974
Hydrogen	281,745	35.64	> ~0.0474
Nitrogen	200,625	25.38	< ~0.0448
Oxygen	51,223	6.48	< ~0.3000
Totals	790,518	100.00	----

Promoter-Terminator Sections
Table: 5820 (Promoter Count: 6)
Link and genome info: KZ115304.1
Danio rerio chromosome 10 genomic contig ALT_CTG10_1_5
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 34,195
Atom	Atom Count	Percent	Variation %
Carbon	164,786	32.53	> ~0.3233
Hydrogen	182,033	35.93	> ~0.3379
Nitrogen	125,423	24.76	< ~0.6667
Oxygen	34,375	6.79	> ~0.0055
Totals	506,617	100.00	----

Promoter-Terminator Sections
Table: 5821 (Promoter Count: 66)
Link and genome info: NW_025791785.1
Homo sapiens chromosome 8 genomic patch of type FIX
GRCh38.p14 PATCHES HG2267_PATCH

Nucleotide count: 305,530
Atom	Atom Count	Percent	Variation %
Carbon	1,463,102	32.39	> ~0.1853
Hydrogen	1,613,702	35.72	> ~0.1293
Nitrogen	1,140,398	25.24	< ~0.1787
Oxygen	300,124	6.64	< ~0.1359
Totals	4,517,326	100.00	----

Promoter-Terminator Sections
Table: 5822 (Promoter Count: 45)
Link and genome info: GL383546.1
Homo sapiens chromosome 10 genomic contig
GRCh38 reference assembly alternate locus group ALT_REF_LOCI_1

Nucleotide count: 172,343
Atom	Atom Count	Percent	Variation %
Carbon	826,370	32.42	> ~0.2131
Hydrogen	907,682	35.61	> ~0.0129
Nitrogen	653,124	25.62	> ~0.1968
Oxygen	162,053	6.36	< ~0.4228
Totals	2,549,229	100.00	----

Promoter-Terminator Sections
Table: 5823 (Promoter Count: 1)
Link and genome info: KN149804.1
Danio rerio unplaced genomic contig NA198
GRCz11 reference primary assembly

Nucleotide count: 6,505
Atom	Atom Count	Percent	Variation %
Carbon	31,329	32.44	> ~0.2384
Hydrogen	34,444	35.67	> ~0.0742
Nitrogen	24,376	25.24	< ~0.1819
Oxygen	6,421	6.65	< ~0.1306
Totals	96,570	100.00	----

Promoter-Terminator Sections
Table: 5824 (Promoter Count: 31)
Link and genome info: NW_018394557.1
Danio rerio strain Tuebingen chromosome 4 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG4_1_11

Nucleotide count: 170,356
Atom	Atom Count	Percent	Variation %
Carbon	819,013	32.46	> ~0.2604
Hydrogen	903,429	35.81	> ~0.2166
Nitrogen	631,299	25.02	< ~0.4005
Oxygen	169,110	6.70	< ~0.0766
Totals	2,522,851	100.00	----

Promoter-Terminator Sections
Table: 5825 (Promoter Count: 41)
Link and genome info: KZ559115.1
Homo sapiens chromosome 18 genomic contig HG2412_PATCH
GRC reference assembly FIX PATCH for GRCh38

Nucleotide count: 131,508
Atom	Atom Count	Percent	Variation %
Carbon	630,393	32.39	> ~0.1837
Hydrogen	696,056	35.76	> ~0.1674
Nitrogen	487,698	25.06	< ~0.3677
Oxygen	132,288	6.80	> ~0.0167
Totals	1,946,435	100.00	----

Promoter-Terminator Sections
Table: 5826 (Promoter Count: 35)
Link and genome info: NW_018394830.1
Danio rerio strain Tuebingen chromosome 12 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG12_1_2

Nucleotide count: 247,121
Atom	Atom Count	Percent	Variation %
Carbon	1,191,095	32.53	> ~0.3258
Hydrogen	1,312,655	35.85	> ~0.2559
Nitrogen	915,435	25.00	< ~0.4228
Oxygen	242,428	6.62	< ~0.1589
Totals	3,661,613	100.00	----

Promoter-Terminator Sections
Table: 5827 (Promoter Count: 48)
Link and genome info: NW_018395278.1
Danio rerio strain Tuebingen chromosome 9 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_2 ALT_CTG9_2_3

Nucleotide count: 275,722
Atom	Atom Count	Percent	Variation %
Carbon	1,329,956	32.54	> ~0.3373
Hydrogen	1,467,435	35.90	> ~0.3113
Nitrogen	1,014,827	24.83	< ~0.5934
Oxygen	274,832	6.72	< ~0.0552
Totals	4,087,050	100.00	----

Promoter-Terminator Sections
Table: 5828 (Promoter Count: 40)
Link and genome info: KZ115144.1
Danio rerio chromosome 5 genomic contig ALT_CTG5_1_46
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 244,010
Atom	Atom Count	Percent	Variation %
Carbon	1,175,832	32.52	> ~0.3119
Hydrogen	1,298,080	35.90	> ~0.3026
Nitrogen	897,524	24.82	< ~0.6045
Oxygen	244,810	6.77	< ~0.0100
Totals	3,616,246	100.00	----

Promoter-Terminator Sections
Table: 5829 (Promoter Count: 65)
Link and genome info: NW_018395075.1
Danio rerio strain Tuebingen chromosome 20 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG20_1_16

Nucleotide count: 312,696
Atom	Atom Count	Percent	Variation %
Carbon	1,507,982	32.53	> ~0.3278
Hydrogen	1,665,484	35.93	> ~0.3357
Nitrogen	1,146,472	24.73	< ~0.6913
Oxygen	315,560	6.81	> ~0.0278
Totals	4,635,498	100.00	----

Promoter-Terminator Sections
Table: 5830 (Promoter Count: 6)
Link and genome info: NT_187373.1
Homo sapiens chromosome 9 unlocalized genomic scaffold
GRCh38.p14 Primary Assembly HSCHR9_UNLOCALIZED_CTG2

Nucleotide count: 29,020
Atom	Atom Count	Percent	Variation %
Carbon	139,332	32.47	> ~0.2674
Hydrogen	154,246	35.95	> ~0.3532
Nitrogen	106,126	24.73	< ~0.6915
Oxygen	29,396	6.85	> ~0.0709
Totals	429,100	100.00	----

Promoter-Terminator Sections
Table: 5831 (Promoter Count: 2)
Link and genome info: NW_008805585.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA1031

Nucleotide count: 37,693
'N' Nucleotide Count: 200
Atom	Atom Count	Percent	Variation %
Carbon	182,024	32.54	> ~0.3353
Hydrogen	200,856	35.91	> ~0.3120
Nitrogen	138,410	24.74	< ~0.6814
Oxygen	38,117	6.81	> ~0.0341
Totals	559,407	100.00	----

Promoter-Terminator Sections
Table: 5832 (Promoter Count: 1)
Link and genome info: KN150271.1
Danio rerio unplaced genomic contig NA627
GRCz11 reference primary assembly

Nucleotide count: 616
Atom	Atom Count	Percent	Variation %
Carbon	2,968	32.58	> ~0.3762
Hydrogen	3,273	35.93	> ~0.3344
Nitrogen	2,277	24.99	< ~0.4292
Oxygen	592	6.50	< ~0.2813
Totals	9,110	100.00	----

Promoter-Terminator Sections
Table: 5833 (Promoter Count: 2)
Link and genome info: NW_020191585.1
Bos taurus isolate L1 Dominette 01449 registration number 42190680 breed Hereford unplaced genomic scaffold
ARS-UCD2.0 Leftover_ScbfJmS_273, whole genome shotgun sequence

Nucleotide count: 2,225
Atom	Atom Count	Percent	Variation %
Carbon	10,559	32.22	> ~0.0191
Hydrogen	11,727	35.79	> ~0.1937
Nitrogen	8,187	24.98	< ~0.4397
Oxygen	2,296	7.01	> ~0.2269
Totals	32,769	100.00	----

Promoter-Terminator Sections
Table: 5834 (Promoter Count: 5)
Link and genome info: KN150639.1
Danio rerio unplaced genomic contig NA973
GRCz11 reference primary assembly

Nucleotide count: 18,244
'N' Nucleotide Count: 400
Atom	Atom Count	Percent	Variation %
Carbon	87,709	32.50	> ~0.2935
Hydrogen	97,203	36.01	> ~0.4212
Nitrogen	66,249	24.55	< ~0.8779
Oxygen	18,739	6.94	> ~0.1632
Totals	269,900	100.00	----

Promoter-Terminator Sections
Table: 5835 (Promoter Count: 180)
Link and genome info: KI270847.1
Homo sapiens chromosome 14 genomic contig
GRCh38 reference assembly alternate locus group ALT_REF_LOCI_1

Nucleotide count: 682,055
Atom	Atom Count	Percent	Variation %
Carbon	3,263,425	32.35	> ~0.1433
Hydrogen	3,601,025	35.69	> ~0.0997
Nitrogen	2,544,325	25.22	< ~0.2047
Oxygen	680,132	6.74	< ~0.0383
Totals	10,088,907	100.00	----

Promoter-Terminator Sections
Table: 5836 (Promoter Count: 18)
Link and genome info: NW_018394646.1
Danio rerio strain Tuebingen chromosome 6 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG6_1_24

Nucleotide count: 109,902
Atom	Atom Count	Percent	Variation %
Carbon	530,068	32.53	> ~0.3291
Hydrogen	585,903	35.96	> ~0.3661
Nitrogen	401,447	24.64	< ~0.7852
Oxygen	111,931	6.87	> ~0.0900
Totals	1,629,349	100.00	----

Promoter-Terminator Sections
Table: 5837 (Promoter Count: 2)
Link and genome info: NKLS02000962.1
Bos taurus breed Hereford isolate L1 Dominette 01449 registration number 42190680 Leftover_ScbfJmS_1954
whole genome shotgun sequence

Nucleotide count: 8,495
Atom	Atom Count	Percent	Variation %
Carbon	39,482	31.92	< ~0.2853
Hydrogen	44,793	36.21	> ~0.6184
Nitrogen	29,535	23.88	< ~1.5470
Oxygen	9,888	7.99	> ~1.2140
Totals	123,698	100.00	----

Promoter-Terminator Sections
Table: 5838 (Promoter Count: 1)
Link and genome info: KN150429.1
Danio rerio unplaced genomic contig NA780
GRCz11 reference primary assembly

Nucleotide count: 3,245
Atom	Atom Count	Percent	Variation %
Carbon	15,505	32.37	> ~0.1627
Hydrogen	17,117	35.73	> ~0.1379
Nitrogen	12,109	25.28	< ~0.1466
Oxygen	3,174	6.63	< ~0.1541
Totals	47,905	100.00	----

Promoter-Terminator Sections
Table: 5839 (Promoter Count: 15)
Link and genome info: KV575248.1
Homo sapiens chromosome 19 genomic contig HSCHR19KIR_CA01-TA01_2_CTG3_1
GRC reference assembly NOVEL PATCH for GRCh38

Nucleotide count: 101,746
Atom	Atom Count	Percent	Variation %
Carbon	486,502	32.29	> ~0.0871
Hydrogen	534,839	35.50	< ~0.0945
Nitrogen	385,947	25.62	> ~0.1927
Oxygen	99,355	6.59	< ~0.1852
Totals	1,506,643	100.00	----

Promoter-Terminator Sections
Table: 5840 (Promoter Count: 54)
Link and genome info: KZ115483.1
Danio rerio chromosome 15 genomic contig ALT_CTG15_1_15
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 306,710
Atom	Atom Count	Percent	Variation %
Carbon	1,480,104	32.54	> ~0.3388
Hydrogen	1,633,828	35.92	> ~0.3289
Nitrogen	1,125,824	24.75	< ~0.6708
Oxygen	308,502	6.78	> ~0.0032
Totals	4,548,258	100.00	----

Promoter-Terminator Sections
Table: 5841 (Promoter Count: 3)
Link and genome info: NW_003336497.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA283

Nucleotide count: 9,148
Atom	Atom Count	Percent	Variation %
Carbon	44,133	32.54	> ~0.3407
Hydrogen	48,708	35.92	> ~0.3245
Nitrogen	33,622	24.79	< ~0.6305
Oxygen	9,147	6.75	< ~0.0346
Totals	135,610	100.00	----

Promoter-Terminator Sections
Table: 5842 (Promoter Count: 3)
Link and genome info: NKLS02001767.1
Bos taurus breed Hereford isolate L1 Dominette 01449 registration number 42190680 Leftover_ScbfJmS_55
whole genome shotgun sequence

Nucleotide count: 3,351
Atom	Atom Count	Percent	Variation %
Carbon	16,007	32.40	> ~0.1962
Hydrogen	17,758	35.94	> ~0.3505
Nitrogen	12,250	24.80	< ~0.6286
Oxygen	3,390	6.86	> ~0.0820
Totals	49,405	100.00	----

Promoter-Terminator Sections
Table: 5843 (Promoter Count: 19)
Link and genome info: NKLS02002138.1
Bos taurus breed Hereford isolate L1 Dominette 01449 registration number 42190680 Leftover_ScbfJmS_935
whole genome shotgun sequence

Nucleotide count: 51,918
Atom	Atom Count	Percent	Variation %
Carbon	249,444	32.44	> ~0.2375
Hydrogen	275,709	35.86	> ~0.2635
Nitrogen	190,941	24.83	< ~0.5913
Oxygen	52,824	6.87	> ~0.0902
Totals	768,918	100.00	----

Promoter-Terminator Sections
Table: 5844 (Promoter Count: 61)
Link and genome info: GL456233.2
Mus musculus chromosome X unlocalized genomic contig MMCHRX_RANDOM_CTG2
GRCm39 reference primary assembly C57BL/6J

Nucleotide count: 204,461
Atom	Atom Count	Percent	Variation %
Carbon	984,795	32.50	> ~0.2951
Hydrogen	1,087,493	35.89	> ~0.2944
Nitrogen	751,721	24.81	< ~0.6167
Oxygen	206,267	6.81	> ~0.0272
Totals	3,030,276	100.00	----

Promoter-Terminator Sections
Table: 5845 (Promoter Count: 44)
Link and genome info: NW_018395260.1
Danio rerio strain Tuebingen chromosome 6 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_2 ALT_CTG6_2_13

Nucleotide count: 276,722
Atom	Atom Count	Percent	Variation %
Carbon	1,335,517	32.54	> ~0.3372
Hydrogen	1,474,997	35.94	> ~0.3459
Nitrogen	1,013,263	24.69	< ~0.7350
Oxygen	280,381	6.83	> ~0.0519
Totals	4,104,158	100.00	----

Promoter-Terminator Sections
Table: 5846 (Promoter Count: 38)
Link and genome info: NW_018394929.1
Danio rerio strain Tuebingen chromosome 14 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG14_1_39

Nucleotide count: 221,859
Atom	Atom Count	Percent	Variation %
Carbon	1,069,549	32.53	> ~0.3275
Hydrogen	1,179,129	35.86	> ~0.2706
Nitrogen	820,301	24.95	< ~0.4738
Oxygen	218,819	6.66	< ~0.1242
Totals	3,287,798	100.00	----

Promoter-Terminator Sections
Table: 5847 (Promoter Count: 46)
Link and genome info: KZ115007.1
Danio rerio chromosome 1 genomic contig ALT_CTG1_1_11
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 332,673
Atom	Atom Count	Percent	Variation %
Carbon	1,602,888	32.52	> ~0.3158
Hydrogen	1,769,472	35.90	> ~0.3057
Nitrogen	1,224,090	24.83	< ~0.5895
Oxygen	332,594	6.75	< ~0.0321
Totals	4,929,044	100.00	----

Promoter-Terminator Sections
Table: 5848 (Promoter Count: 23)
Link and genome info: NW_018395147.1
Danio rerio strain Tuebingen chromosome 23 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG23_1_21

Nucleotide count: 123,908
Atom	Atom Count	Percent	Variation %
Carbon	597,691	32.51	> ~0.3091
Hydrogen	660,547	35.93	> ~0.3384
Nitrogen	452,821	24.63	< ~0.7917
Oxygen	127,286	6.92	> ~0.1442
Totals	1,838,345	100.00	----

Promoter-Terminator Sections
Table: 5849 (Promoter Count: 2)
Link and genome info: NW_018395138.1
Danio rerio strain Tuebingen chromosome 23 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG23_1_12

Nucleotide count: 2,109
Atom	Atom Count	Percent	Variation %
Carbon	10,206	32.59	> ~0.3870
Hydrogen	11,202	35.77	> ~0.1777
Nitrogen	7,896	25.21	< ~0.2098
Oxygen	2,012	6.42	< ~0.3549
Totals	31,316	100.00	----

Promoter-Terminator Sections
Table: 5850 (Promoter Count: 59)
Link and genome info: KZ114876.1
Danio rerio chromosome 6 genomic contig ALT_CTG6_2_3
GRCz11 reference assembly alternate locus group ALT_DRER_TU_2

Nucleotide count: 335,572
Atom	Atom Count	Percent	Variation %
Carbon	1,613,255	32.45	> ~0.2509
Hydrogen	1,780,091	35.81	> ~0.2174
Nitrogen	1,241,957	24.98	< ~0.4389
Oxygen	335,550	6.75	< ~0.0293
Totals	4,970,853	100.00	----

Promoter-Terminator Sections
Table: 5851 (Promoter Count: 1)
Link and genome info: NKLS02000882.1
Bos taurus breed Hereford isolate L1 Dominette 01449 registration number 42190680 Leftover_ScbfJmS_1869
whole genome shotgun sequence

Nucleotide count: 2,898
Atom	Atom Count	Percent	Variation %
Carbon	13,831	32.40	> ~0.1991
Hydrogen	15,516	36.35	> ~0.7568
Nitrogen	10,094	23.65	< ~1.7760
Oxygen	3,244	7.60	> ~0.8202
Totals	42,685	100.00	----

Promoter-Terminator Sections
Table: 5852 (Promoter Count: 2)
Link and genome info: NW_003336534.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA835

Nucleotide count: 20,823
'N' Nucleotide Count: 600
Atom	Atom Count	Percent	Variation %
Carbon	98,960	32.14	< ~0.0641
Hydrogen	108,954	35.39	< ~0.2082
Nitrogen	79,288	25.75	> ~0.3267
Oxygen	20,708	6.73	< ~0.0544
Totals	307,910	100.00	----

Promoter-Terminator Sections
Table: 5853 (Promoter Count: 3)
Link and genome info: NW_021160012.1
Homo sapiens chromosome 13 genomic patch of type FIX
GRCh38.p14 PATCHES HG2509_PATCH

Nucleotide count: 67,295
Atom	Atom Count	Percent	Variation %
Carbon	322,421	32.34	> ~0.1394
Hydrogen	353,938	35.50	< ~0.0888
Nitrogen	255,978	25.68	> ~0.2541
Oxygen	64,548	6.47	< ~0.3047
Totals	996,885	100.00	----

Promoter-Terminator Sections
Table: 5854 (Promoter Count: 34)
Link and genome info: KZ115476.1
Danio rerio chromosome 15 genomic contig ALT_CTG15_1_8
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 165,730
Atom	Atom Count	Percent	Variation %
Carbon	799,387	32.54	> ~0.3329
Hydrogen	882,760	35.93	> ~0.3366
Nitrogen	607,794	24.74	< ~0.6855
Oxygen	166,964	6.80	> ~0.0160
Totals	2,456,905	100.00	----

Promoter-Terminator Sections
Table: 5855 (Promoter Count: 29)
Link and genome info: KI270801.1
Homo sapiens chromosome 6 genomic contig
GRCh38 reference assembly alternate locus group ALT_REF_LOCI_1

Nucleotide count: 92,400
Atom	Atom Count	Percent	Variation %
Carbon	445,750	32.55	> ~0.3416
Hydrogen	492,473	35.96	> ~0.3631
Nitrogen	338,081	24.68	< ~0.7398
Oxygen	93,338	6.81	> ~0.0351
Totals	1,369,642	100.00	----

Promoter-Terminator Sections
Table: 5856 (Promoter Count: 25)
Link and genome info: KZ114957.1
Danio rerio chromosome 17 genomic contig ALT_CTG17_2_6
GRCz11 reference assembly alternate locus group ALT_DRER_TU_2

Nucleotide count: 151,566
Atom	Atom Count	Percent	Variation %
Carbon	731,313	32.54	> ~0.3380
Hydrogen	808,005	35.95	> ~0.3608
Nitrogen	554,271	24.66	< ~0.7602
Oxygen	153,744	6.84	> ~0.0615
Totals	2,247,333	100.00	----

Promoter-Terminator Sections
Table: 5857 (Promoter Count: 3)
Link and genome info: NW_003337160.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA357

Nucleotide count: 6,585
'N' Nucleotide Count: 100
Atom	Atom Count	Percent	Variation %
Carbon	31,770	32.52	> ~0.3182
Hydrogen	35,113	35.94	> ~0.3505
Nitrogen	24,051	24.62	< ~0.8037
Oxygen	6,755	6.91	> ~0.1351
Totals	97,689	100.00	----

Promoter-Terminator Sections
Table: 5858 (Promoter Count: 88)
Link and genome info: CM008176.2
Bos taurus isolate L1 Dominette 01449 registration number 42190680 breed Hereford chromosome 9
whole genome shotgun sequence

Nucleotide count: 343,171
Atom	Atom Count	Percent	Variation %
Carbon	1,647,025	32.41	> ~0.2095
Hydrogen	1,814,420	35.71	> ~0.1140
Nitrogen	1,282,500	25.24	< ~0.1845
Oxygen	337,440	6.64	< ~0.1390
Totals	5,081,385	100.00	----

Promoter-Terminator Sections
Table: 5859 (Promoter Count: 1)
Link and genome info: KN150413.1
Danio rerio unplaced genomic contig NA73
GRCz11 reference primary assembly

Nucleotide count: 9,250
'N' Nucleotide Count: 200
Atom	Atom Count	Percent	Variation %
Carbon	44,653	32.54	> ~0.3380
Hydrogen	49,282	35.91	> ~0.3217
Nitrogen	33,960	24.75	< ~0.6749
Oxygen	9,324	6.79	> ~0.0153
Totals	137,219	100.00	----

Promoter-Terminator Sections
Table: 5860 (Promoter Count: 2)
Link and genome info: NW_018394431.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA773

Nucleotide count: 9,849
'N' Nucleotide Count: 100
Atom	Atom Count	Percent	Variation %
Carbon	47,188	32.56	> ~0.3612
Hydrogen	52,405	36.16	> ~0.5716
Nitrogen	35,651	24.60	< ~0.8209
Oxygen	9,662	6.67	< ~0.1119
Totals	144,906	100.00	----

Promoter-Terminator Sections
Table: 5861 (Promoter Count: 4)
Link and genome info: NW_020191430.1
Bos taurus isolate L1 Dominette 01449 registration number 42190680 breed Hereford unplaced genomic scaffold
ARS-UCD2.0 Leftover_ScbfJmS_2357, whole genome shotgun sequence

Nucleotide count: 8,483
Atom	Atom Count	Percent	Variation %
Carbon	41,012	32.49	> ~0.2870
Hydrogen	44,837	35.52	< ~0.0726
Nitrogen	32,343	25.62	> ~0.1990
Oxygen	8,036	6.37	< ~0.4134
Totals	126,228	100.00	----

Promoter-Terminator Sections
Table: 5862 (Promoter Count: 1)
Link and genome info: NKLS02000921.1
Bos taurus breed Hereford isolate L1 Dominette 01449 registration number 42190680 Leftover_ScbfJmS_1909
whole genome shotgun sequence

Nucleotide count: 96
Atom	Atom Count	Percent	Variation %
Carbon	462	32.33	> ~0.1269
Hydrogen	507	35.48	< ~0.1138
Nitrogen	363	25.40	< ~0.0213
Oxygen	97	6.79	> ~0.0083
Totals	1,429	100.00	----

Promoter-Terminator Sections
Table: 5863 (Promoter Count: 1)
Link and genome info: KN149893.1
Danio rerio unplaced genomic contig NA278
GRCz11 reference primary assembly

Nucleotide count: 5,719
Atom	Atom Count	Percent	Variation %
Carbon	27,363	32.39	> ~0.1854
Hydrogen	30,301	35.87	> ~0.2732
Nitrogen	21,013	24.87	< ~0.5512
Oxygen	5,806	6.87	> ~0.0927
Totals	84,483	100.00	----

Promoter-Terminator Sections
Table: 5864 (Promoter Count: 12)
Link and genome info: NW_003315938.1
Homo sapiens chromosome 12 genomic scaffold
GRCh38.p14 alternate locus group ALT_REF_LOCI_1 HSCHR12_1_CTG2

Nucleotide count: 30,898
Atom	Atom Count	Percent	Variation %
Carbon	148,609	32.48	> ~0.2728
Hydrogen	163,822	35.80	> ~0.2076
Nitrogen	114,732	25.07	< ~0.3508
Oxygen	30,430	6.65	< ~0.1297
Totals	457,593	100.00	----

Promoter-Terminator Sections
Table: 5865 (Promoter Count: 22)
Link and genome info: CM008171.2
Bos taurus isolate L1 Dominette 01449 registration number 42190680 breed Hereford chromosome 4
whole genome shotgun sequence

Nucleotide count: 70,800
Atom	Atom Count	Percent	Variation %
Carbon	336,508	32.29	> ~0.0854
Hydrogen	372,556	35.75	> ~0.1545
Nitrogen	263,348	25.27	< ~0.1548
Oxygen	69,771	6.69	< ~0.0850
Totals	1,042,183	100.00	----

Promoter-Terminator Sections
Table: 5866 (Promoter Count: 58)
Link and genome info: KZ115376.1
Danio rerio chromosome 12 genomic contig ALT_CTG12_1_11
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 414,955
Atom	Atom Count	Percent	Variation %
Carbon	2,001,260	32.54	> ~0.3325
Hydrogen	2,207,045	35.88	> ~0.2882
Nitrogen	1,530,935	24.89	< ~0.5342
Oxygen	411,697	6.69	< ~0.0865
Totals	6,150,937	100.00	----

Promoter-Terminator Sections
Table: 5867 (Promoter Count: 4)
Link and genome info: NW_003334684.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA208

Nucleotide count: 26,198
'N' Nucleotide Count: 600
Atom	Atom Count	Percent	Variation %
Carbon	126,438	32.56	> ~0.3528
Hydrogen	139,183	35.84	> ~0.2446
Nitrogen	97,307	25.06	< ~0.3684
Oxygen	25,441	6.55	< ~0.2290
Totals	388,369	100.00	----

Promoter-Terminator Sections
Table: 5868 (Promoter Count: 4)
Link and genome info: NW_020192228.1
Bos taurus isolate L1 Dominette 01449 registration number 42190680 breed Hereford unplaced genomic scaffold
ARS-UCD2.0 Leftover_ScbfJmS_940, whole genome shotgun sequence

Nucleotide count: 19,242
Atom	Atom Count	Percent	Variation %
Carbon	92,278	32.42	> ~0.2200
Hydrogen	101,571	35.69	> ~0.0955
Nitrogen	72,263	25.39	< ~0.0329
Oxygen	18,491	6.50	< ~0.2826
Totals	284,603	100.00	----

Promoter-Terminator Sections
Table: 5869 (Promoter Count: 51)
Link and genome info: KZ115679.1
Danio rerio chromosome 23 genomic contig ALT_CTG23_1_16
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 314,968
Atom	Atom Count	Percent	Variation %
Carbon	1,518,318	32.53	> ~0.3310
Hydrogen	1,676,171	35.92	> ~0.3237
Nitrogen	1,157,803	24.81	< ~0.6143
Oxygen	314,509	6.74	< ~0.0404
Totals	4,666,801	100.00	----

Promoter-Terminator Sections
Table: 5870 (Promoter Count: 2)
Link and genome info: NW_003337162.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA544

Nucleotide count: 4,201
Atom	Atom Count	Percent	Variation %
Carbon	20,266	32.52	> ~0.3190
Hydrogen	22,340	35.85	> ~0.2575
Nitrogen	15,522	24.91	< ~0.5144
Oxygen	4,186	6.72	< ~0.0621
Totals	62,314	100.00	----

Promoter-Terminator Sections
Table: 5871 (Promoter Count: 1)
Link and genome info: NW_008805423.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA403

Nucleotide count: 11,613
Atom	Atom Count	Percent	Variation %
Carbon	56,000	32.53	> ~0.3290
Hydrogen	61,804	35.90	> ~0.3110
Nitrogen	42,718	24.82	< ~0.6073
Oxygen	11,614	6.75	< ~0.0327
Totals	172,136	100.00	----

Promoter-Terminator Sections
Table: 5872 (Promoter Count: 29)
Link and genome info: NT_187640.1
Homo sapiens chromosome 19 genomic scaffold
GRCh38.p14 alternate locus group ALT_REF_LOCI_14 HSCHR19KIR_G248_BA2_HAP_CTG3_1

Nucleotide count: 74,184
Atom	Atom Count	Percent	Variation %
Carbon	354,533	32.32	> ~0.1189
Hydrogen	390,938	35.64	> ~0.0481
Nitrogen	278,092	25.35	< ~0.0704
Oxygen	73,305	6.68	< ~0.0966
Totals	1,096,868	100.00	----

Promoter-Terminator Sections
Table: 5873 (Promoter Count: 8)
Link and genome info: NKLS02000728.1
Bos taurus breed Hereford isolate L1 Dominette 01449 registration number 42190680 Leftover_ScbfJmS_1713
whole genome shotgun sequence

Nucleotide count: 29,915
Atom	Atom Count	Percent	Variation %
Carbon	142,887	32.36	> ~0.1541
Hydrogen	157,298	35.62	> ~0.0278
Nitrogen	113,030	25.60	> ~0.1726
Oxygen	28,373	6.43	< ~0.3545
Totals	441,588	100.00	----

Promoter-Terminator Sections
Table: 5874 (Promoter Count: 1)
Link and genome info: NKLS02001958.1
Bos taurus breed Hereford isolate L1 Dominette 01449 registration number 42190680 Leftover_ScbfJmS_743
whole genome shotgun sequence

Nucleotide count: 6,962
Atom	Atom Count	Percent	Variation %
Carbon	33,466	32.48	> ~0.2784
Hydrogen	36,975	35.89	> ~0.2944
Nitrogen	25,627	24.87	< ~0.5504
Oxygen	6,962	6.76	< ~0.0224
Totals	103,030	100.00	----

Promoter-Terminator Sections
Table: 5875 (Promoter Count: 49)
Link and genome info: NW_021160000.1
Homo sapiens chromosome 10 genomic patch of type FIX
GRCh38.p14 PATCHES HG545_PATCH

Nucleotide count: 365,016
Atom	Atom Count	Percent	Variation %
Carbon	1,768,968	32.44	> ~0.2376
Hydrogen	1,920,657	35.22	< ~0.3704
Nitrogen	1,426,125	26.15	> ~0.7299
Oxygen	337,130	6.18	< ~0.5971
Totals	5,452,880	100.00	----

Promoter-Terminator Sections
Table: 5876 (Promoter Count: 36)
Link and genome info: KZ114971.1
Danio rerio chromosome 21 genomic contig ALT_CTG21_2_1
GRCz11 reference assembly alternate locus group ALT_DRER_TU_2

Nucleotide count: 174,767
Atom	Atom Count	Percent	Variation %
Carbon	843,034	32.55	> ~0.3435
Hydrogen	929,369	35.88	> ~0.2868
Nitrogen	645,631	24.93	< ~0.4979
Oxygen	172,180	6.65	< ~0.1324
Totals	2,590,214	100.00	----

Promoter-Terminator Sections
Table: 5877 (Promoter Count: 2)
Link and genome info: NKLS02000789.1
Bos taurus breed Hereford isolate L1 Dominette 01449 registration number 42190680 Leftover_ScbfJmS_1771
whole genome shotgun sequence

Nucleotide count: 79,535
'N' Nucleotide Count: 25
Atom	Atom Count	Percent	Variation %
Carbon	378,243	32.28	> ~0.0791
Hydrogen	419,479	35.80	> ~0.2087
Nitrogen	293,399	25.04	< ~0.3825
Oxygen	80,546	6.87	> ~0.0948
Totals	1,171,667	100.00	----

Promoter-Terminator Sections
Table: 5878 (Promoter Count: 2)
Link and genome info: NKLS02001935.1
Bos taurus breed Hereford isolate L1 Dominette 01449 registration number 42190680 Leftover_ScbfJmS_72
whole genome shotgun sequence

Nucleotide count: 4,817
Atom	Atom Count	Percent	Variation %
Carbon	23,082	32.40	> ~0.1969
Hydrogen	25,630	35.98	> ~0.3838
Nitrogen	17,444	24.49	< ~0.9375
Oxygen	5,084	7.14	> ~0.3567
Totals	71,240	100.00	----

Promoter-Terminator Sections
Table: 5879 (Promoter Count: 34)
Link and genome info: NW_018394459.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly CTG20007

Nucleotide count: 100,187
Atom	Atom Count	Percent	Variation %
Carbon	482,045	32.49	> ~0.2902
Hydrogen	532,198	35.87	> ~0.2811
Nitrogen	369,366	24.90	< ~0.5255
Oxygen	99,898	6.73	< ~0.0458
Totals	1,483,507	100.00	----

Promoter-Terminator Sections
Table: 5880 (Promoter Count: 21)
Link and genome info: GL000216.2
Homo sapiens unplaced genomic contig
GRCh38 reference primary assembly

Nucleotide count: 85,360
Atom	Atom Count	Percent	Variation %
Carbon	404,553	32.41	> ~0.2057
Hydrogen	456,127	36.54	> ~0.9475
Nitrogen	294,325	23.58	< ~1.8451
Oxygen	93,266	7.47	> ~0.6919
Totals	1,248,271	100.00	----

Promoter-Terminator Sections
Table: 5881 (Promoter Count: 36)
Link and genome info: NW_018394474.1
Danio rerio strain Tuebingen chromosome 1 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG1_1_15

Nucleotide count: 317,034
Atom	Atom Count	Percent	Variation %
Carbon	1,530,771	32.55	> ~0.3465
Hydrogen	1,688,952	35.91	> ~0.3202
Nitrogen	1,165,026	24.77	< ~0.6509
Oxygen	318,097	6.76	< ~0.0158
Totals	4,702,846	100.00	----

Promoter-Terminator Sections
Table: 5882 (Promoter Count: 8)
Link and genome info: NC_037338.1
Bos taurus isolate L1 Dominette 01449 registration number 42190680 breed Hereford chromosome 11
ARS-UCD2.0, whole genome shotgun sequence

Nucleotide count: 46,715
Atom	Atom Count	Percent	Variation %
Carbon	223,497	32.37	> ~0.1646
Hydrogen	246,830	35.75	> ~0.1540
Nitrogen	173,654	25.15	< ~0.2742
Oxygen	46,507	6.74	< ~0.0443
Totals	690,488	100.00	----

Promoter-Terminator Sections
Table: 5883 (Promoter Count: 2)
Link and genome info: NW_020191932.1
Bos taurus isolate L1 Dominette 01449 registration number 42190680 breed Hereford unplaced genomic scaffold
ARS-UCD2.0 Leftover_ScbfJmS_634, whole genome shotgun sequence

Nucleotide count: 5,018
Atom	Atom Count	Percent	Variation %
Carbon	24,066	32.45	> ~0.2424
Hydrogen	26,649	35.93	> ~0.3350
Nitrogen	18,365	24.76	< ~0.6640
Oxygen	5,093	6.87	> ~0.0867
Totals	74,173	100.00	----

Promoter-Terminator Sections
Table: 5884 (Promoter Count: 2)
Link and genome info: KN150464.1
Danio rerio unplaced genomic contig NA813
GRCz11 reference primary assembly

Nucleotide count: 16,155
'N' Nucleotide Count: 200
Atom	Atom Count	Percent	Variation %
Carbon	77,717	32.50	> ~0.3010
Hydrogen	85,831	35.90	> ~0.3048
Nitrogen	59,491	24.88	< ~0.5422
Oxygen	16,058	6.72	< ~0.0636
Totals	239,097	100.00	----

Promoter-Terminator Sections
Table: 5885 (Promoter Count: 1)
Link and genome info: KN150636.1
Danio rerio unplaced genomic contig NA971
GRCz11 reference primary assembly

Nucleotide count: 8,704
Atom	Atom Count	Percent	Variation %
Carbon	41,887	32.50	> ~0.2926
Hydrogen	46,227	35.86	> ~0.2698
Nitrogen	32,133	24.93	< ~0.4949
Oxygen	8,652	6.71	< ~0.0675
Totals	128,899	100.00	----

Promoter-Terminator Sections
Table: 5886 (Promoter Count: 4)
Link and genome info: KN150255.2
Danio rerio unplaced genomic contig NA615
GRCz11 reference primary assembly

Nucleotide count: 26,629
'N' Nucleotide Count: 400
Atom	Atom Count	Percent	Variation %
Carbon	128,162	32.55	> ~0.3426
Hydrogen	141,416	35.91	> ~0.3186
Nitrogen	98,366	24.98	< ~0.4442
Oxygen	25,843	6.56	< ~0.2170
Totals	393,787	100.00	----

Promoter-Terminator Sections
Table: 5887 (Promoter Count: 1)
Link and genome info: NW_003336975.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA900

Nucleotide count: 1,690
Atom	Atom Count	Percent	Variation %
Carbon	8,164	32.63	> ~0.4265
Hydrogen	9,026	36.08	> ~0.4819
Nitrogen	6,150	24.58	< ~0.8434
Oxygen	1,680	6.71	< ~0.0651
Totals	25,020	100.00	----

Promoter-Terminator Sections
Table: 5888 (Promoter Count: 110)
Link and genome info: CP071560.1
Sus scrofa scrofa breed NS chromosome 9

Nucleotide count: 827,315
'N' Nucleotide Count: 31
Atom	Atom Count	Percent	Variation %
Carbon	3,934,278	32.21	> ~0.0024
Hydrogen	4,352,919	35.63	> ~0.0396
Nitrogen	3,082,949	25.24	< ~0.1868
Oxygen	845,914	6.92	> ~0.1449
Totals	12,216,060	100.00	----

Promoter-Terminator Sections
Table: 5889 (Promoter Count: 1)
Link and genome info: NKLS02002089.1
Bos taurus breed Hereford isolate L1 Dominette 01449 registration number 42190680 Leftover_ScbfJmS_886
whole genome shotgun sequence

Nucleotide count: 1,559
Atom	Atom Count	Percent	Variation %
Carbon	7,450	32.42	> ~0.2133
Hydrogen	8,249	35.89	> ~0.3001
Nitrogen	5,743	24.99	< ~0.4346
Oxygen	1,540	6.70	< ~0.0788
Totals	22,982	100.00	----

Promoter-Terminator Sections
Table: 5890 (Promoter Count: 3)
Link and genome info: KN150244.1
Danio rerio unplaced genomic contig NA605
GRCz11 reference primary assembly

Nucleotide count: 15,307
'N' Nucleotide Count: 100
Atom	Atom Count	Percent	Variation %
Carbon	73,866	32.57	> ~0.3639
Hydrogen	81,669	36.01	> ~0.4145
Nitrogen	55,795	24.60	< ~0.8238
Oxygen	15,480	6.83	> ~0.0454
Totals	226,810	100.00	----

Promoter-Terminator Sections
Table: 5891 (Promoter Count: 15)
Link and genome info: KZ115084.1
Danio rerio chromosome 4 genomic contig ALT_CTG4_1_1
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 103,766
Atom	Atom Count	Percent	Variation %
Carbon	500,206	32.54	> ~0.3346
Hydrogen	551,101	35.85	> ~0.2555
Nitrogen	384,769	25.03	< ~0.3948
Oxygen	101,222	6.58	< ~0.1953
Totals	1,537,298	100.00	----

Promoter-Terminator Sections
Table: 5892 (Promoter Count: 33)
Link and genome info: KZ115131.1
Danio rerio chromosome 5 genomic contig ALT_CTG5_1_33
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 247,519
Atom	Atom Count	Percent	Variation %
Carbon	1,193,700	32.53	> ~0.3279
Hydrogen	1,318,147	35.92	> ~0.3296
Nitrogen	908,149	24.75	< ~0.6744
Oxygen	249,397	6.80	> ~0.0170
Totals	3,669,393	100.00	----

Promoter-Terminator Sections
Table: 5893 (Promoter Count: 3)
Link and genome info: NW_003337040.2
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA512

Nucleotide count: 28,746
'N' Nucleotide Count: 300
Atom	Atom Count	Percent	Variation %
Carbon	138,846	32.58	> ~0.3776
Hydrogen	153,351	35.98	> ~0.3914
Nitrogen	105,099	24.66	< ~0.7617
Oxygen	28,861	6.77	< ~0.0073
Totals	426,157	100.00	----

Promoter-Terminator Sections
Table: 5894 (Promoter Count: 1)
Link and genome info: NW_008805508.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA737

Nucleotide count: 10,433
Atom	Atom Count	Percent	Variation %
Carbon	50,272	32.53	> ~0.3235
Hydrogen	55,627	35.99	> ~0.3985
Nitrogen	37,993	24.58	< ~0.8415
Oxygen	10,663	6.90	> ~0.1195
Totals	154,555	100.00	----

Promoter-Terminator Sections
Table: 5895 (Promoter Count: 9)
Link and genome info: CM001002.3
Mus musculus chromosome 9
GRCm39 reference primary assembly C57BL/6J

Nucleotide count: 26,863
Atom	Atom Count	Percent	Variation %
Carbon	128,752	32.37	> ~0.1710
Hydrogen	141,530	35.59	< ~0.0058
Nitrogen	101,544	25.53	> ~0.1093
Oxygen	25,871	6.51	< ~0.2745
Totals	397,697	100.00	----

Promoter-Terminator Sections
Table: 5896 (Promoter Count: 45)
Link and genome info: KV575243.1
Homo sapiens chromosome 5 genomic contig HSCHR5_8_CTG1
GRC reference assembly NOVEL PATCH for GRCh38

Nucleotide count: 133,552
Atom	Atom Count	Percent	Variation %
Carbon	643,191	32.48	> ~0.2791
Hydrogen	710,274	35.87	> ~0.2771
Nitrogen	491,080	24.80	< ~0.6231
Oxygen	135,571	6.85	> ~0.0669
Totals	1,980,116	100.00	----

Promoter-Terminator Sections
Table: 5897 (Promoter Count: 13)
Link and genome info: NW_021159993.1
Homo sapiens chromosome 4 genomic patch of type FIX
GRCh38.p14 PATCHES HG1298_PATCH

Nucleotide count: 111,263
Atom	Atom Count	Percent	Variation %
Carbon	526,726	32.13	< ~0.0768
Hydrogen	580,728	35.42	< ~0.1728
Nitrogen	423,898	25.85	> ~0.4311
Oxygen	108,178	6.60	< ~0.1816
Totals	1,639,530	100.00	----

Promoter-Terminator Sections
Table: 5898 (Promoter Count: 16)
Link and genome info: KZ115757.1
Danio rerio chromosome 9 genomic contig ALT_CTG9_3_1
GRCz11 reference assembly alternate locus group ALT_DRER_TU_3

Nucleotide count: 157,428
Atom	Atom Count	Percent	Variation %
Carbon	759,548	32.54	> ~0.3329
Hydrogen	837,404	35.87	> ~0.2782
Nitrogen	581,164	24.89	< ~0.5287
Oxygen	156,347	6.70	< ~0.0824
Totals	2,334,463	100.00	----

Promoter-Terminator Sections
Table: 5899 (Promoter Count: 5)
Link and genome info: KN150642.1
Danio rerio unplaced genomic contig NA976
GRCz11 reference primary assembly

Nucleotide count: 42,952
'N' Nucleotide Count: 301
Atom	Atom Count	Percent	Variation %
Carbon	207,651	32.50	> ~0.2956
Hydrogen	227,011	35.53	< ~0.0642
Nitrogen	163,789	25.63	> ~0.2105
Oxygen	40,495	6.34	< ~0.4419
Totals	638,946	100.00	----

Promoter-Terminator Sections
Table: 5900 (Promoter Count: 28)
Link and genome info: KI270840.1
Homo sapiens chromosome 13 genomic contig
GRCh38 reference assembly alternate locus group ALT_REF_LOCI_1

Nucleotide count: 125,556
Atom	Atom Count	Percent	Variation %
Carbon	599,730	32.40	> ~0.1993
Hydrogen	663,657	35.86	> ~0.2634
Nitrogen	464,049	25.07	< ~0.3517
Oxygen	123,428	6.67	< ~0.1110
Totals	1,850,864	100.00	----

Promoter-Terminator Sections
Table: 5901 (Promoter Count: 21)
Link and genome info: KZ115204.1
Danio rerio chromosome 6 genomic contig ALT_CTG6_1_45
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 107,829
Atom	Atom Count	Percent	Variation %
Carbon	519,995	32.54	> ~0.3322
Hydrogen	572,896	35.85	> ~0.2524
Nitrogen	399,592	25.00	< ~0.4216
Oxygen	105,749	6.62	< ~0.1631
Totals	1,598,232	100.00	----

Promoter-Terminator Sections
Table: 5902 (Promoter Count: 1)
Link and genome info: NW_020191342.1
Bos taurus isolate L1 Dominette 01449 registration number 42190680 breed Hereford unplaced genomic scaffold
ARS-UCD2.0 Leftover_ScbfJmS_2265, whole genome shotgun sequence

Nucleotide count: 696
Atom	Atom Count	Percent	Variation %
Carbon	3,311	32.37	> ~0.1654
Hydrogen	3,709	36.26	> ~0.6665
Nitrogen	2,455	24.00	< ~1.4233
Oxygen	754	7.37	> ~0.5915
Totals	10,229	100.00	----

Promoter-Terminator Sections
Table: 5903 (Promoter Count: 9)
Link and genome info: NW_003337060.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA993

Nucleotide count: 59,416
'N' Nucleotide Count: 701
Atom	Atom Count	Percent	Variation %
Carbon	286,213	32.51	> ~0.3051
Hydrogen	315,735	35.86	> ~0.2685
Nitrogen	219,381	24.92	< ~0.5060
Oxygen	59,095	6.71	< ~0.0676
Totals	880,424	100.00	----

Promoter-Terminator Sections
Table: 5904 (Promoter Count: 1)
Link and genome info: NT_187460.1
Homo sapiens unplaced genomic scaffold
GRCh38.p14 Primary Assembly HSCHRUN_RANDOM_168

Nucleotide count: 502
Atom	Atom Count	Percent	Variation %
Carbon	2,415	32.43	> ~0.2301
Hydrogen	2,670	35.86	> ~0.2650
Nitrogen	1,840	24.71	< ~0.7124
Oxygen	521	7.00	> ~0.2173
Totals	7,446	100.00	----

Promoter-Terminator Sections
Table: 5905 (Promoter Count: 42)
Link and genome info: KN196480.1
Homo sapiens chromosome 10 genomic contig HG2191_PATCH
GRC reference assembly FIX PATCH for GRCh38

Nucleotide count: 201,148
Atom	Atom Count	Percent	Variation %
Carbon	964,912	32.38	> ~0.1806
Hydrogen	1,065,790	35.77	> ~0.1765
Nitrogen	743,934	24.97	< ~0.4561
Oxygen	204,957	6.88	> ~0.0990
Totals	2,979,593	100.00	----

Promoter-Terminator Sections
Table: 5906 (Promoter Count: 3)
Link and genome info: NW_020190286.1
Bos taurus isolate L1 Dominette 01449 registration number 42190680 breed Hereford unplaced genomic scaffold
ARS-UCD2.0 Leftover_ScbfJmS_118, whole genome shotgun sequence

Nucleotide count: 10,111
Atom	Atom Count	Percent	Variation %
Carbon	48,540	32.48	> ~0.2813
Hydrogen	53,140	35.56	< ~0.0300
Nitrogen	38,770	25.95	> ~0.5226
Oxygen	8,974	6.01	< ~0.7740
Totals	149,424	100.00	----

Promoter-Terminator Sections
Table: 5907 (Promoter Count: 26)
Link and genome info: NKLS02000295.1
Bos taurus breed Hereford isolate L1 Dominette 01449 registration number 42190680 Leftover_ScbfJmS_1274
whole genome shotgun sequence

Nucleotide count: 122,656
Atom	Atom Count	Percent	Variation %
Carbon	587,821	32.39	> ~0.1882
Hydrogen	648,348	35.73	> ~0.1337
Nitrogen	457,158	25.19	< ~0.2322
Oxygen	121,406	6.69	< ~0.0897
Totals	1,814,733	100.00	----

Promoter-Terminator Sections
Table: 5908 (Promoter Count: 82)
Link and genome info: CM008195.2
Bos taurus isolate L1 Dominette 01449 registration number 42190680 breed Hereford chromosome 28
whole genome shotgun sequence

Nucleotide count: 293,564
Atom	Atom Count	Percent	Variation %
Carbon	1,412,557	32.49	> ~0.2856
Hydrogen	1,558,974	35.86	> ~0.2634
Nitrogen	1,083,832	24.93	< ~0.4954
Oxygen	292,436	6.73	< ~0.0536
Totals	4,347,799	100.00	----

Promoter-Terminator Sections
Table: 5909 (Promoter Count: 1)
Link and genome info: KN150009.1
Danio rerio unplaced genomic contig NA385
GRCz11 reference primary assembly

Nucleotide count: 6,628
Atom	Atom Count	Percent	Variation %
Carbon	32,064	32.48	> ~0.2750
Hydrogen	35,365	35.82	> ~0.2289
Nitrogen	24,313	24.63	< ~0.7965
Oxygen	6,982	7.07	> ~0.2925
Totals	98,724	100.00	----

Promoter-Terminator Sections
Table: 5910 (Promoter Count: 42)
Link and genome info: NW_018395025.1
Danio rerio strain Tuebingen chromosome 18 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG18_1_25

Nucleotide count: 290,170
Atom	Atom Count	Percent	Variation %
Carbon	1,399,252	32.52	> ~0.3197
Hydrogen	1,544,921	35.91	> ~0.3157
Nitrogen	1,065,441	24.76	< ~0.6594
Oxygen	292,718	6.80	> ~0.0240
Totals	4,302,332	100.00	----

Promoter-Terminator Sections
Table: 5911 (Promoter Count: 51)
Link and genome info: NW_018394549.1
Danio rerio strain Tuebingen chromosome 4 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG4_1_3

Nucleotide count: 306,216
Atom	Atom Count	Percent	Variation %
Carbon	1,476,137	32.52	> ~0.3209
Hydrogen	1,627,762	35.87	> ~0.2719
Nitrogen	1,131,148	24.92	< ~0.5007
Oxygen	303,519	6.69	< ~0.0921
Totals	4,538,566	100.00	----

Promoter-Terminator Sections
Table: 5912 (Promoter Count: 1)
Link and genome info: NKLS02002167.1
Bos taurus breed Hereford isolate L1 Dominette 01449 registration number 42190680 Leftover_ScbfJmS_962
whole genome shotgun sequence

Nucleotide count: 11,594
Atom	Atom Count	Percent	Variation %
Carbon	55,448	32.34	> ~0.1399
Hydrogen	61,324	35.77	> ~0.1776
Nitrogen	42,864	25.00	< ~0.4208
Oxygen	11,800	6.88	> ~0.1033
Totals	171,436	100.00	----

Promoter-Terminator Sections
Table: 5913 (Promoter Count: 1)
Link and genome info: KN150546.1
Danio rerio unplaced genomic contig NA85
GRCz11 reference primary assembly

Nucleotide count: 5,614
Atom	Atom Count	Percent	Variation %
Carbon	27,057	32.52	> ~0.3178
Hydrogen	29,912	35.95	> ~0.3596
Nitrogen	20,518	24.66	< ~0.7620
Oxygen	5,711	6.86	> ~0.0846
Totals	83,198	100.00	----

Promoter-Terminator Sections
Table: 5914 (Promoter Count: 74)
Link and genome info: KI270821.1
Homo sapiens chromosome 8 genomic contig
GRCh38 reference assembly alternate locus group ALT_REF_LOCI_1

Nucleotide count: 427,468
Atom	Atom Count	Percent	Variation %
Carbon	2,041,299	32.29	> ~0.0826
Hydrogen	2,255,632	35.68	> ~0.0828
Nitrogen	1,590,382	25.15	< ~0.2696
Oxygen	435,238	6.88	> ~0.1042
Totals	6,322,551	100.00	----

Promoter-Terminator Sections
Table: 5915 (Promoter Count: 4)
Link and genome info: NW_020191396.1
Bos taurus isolate L1 Dominette 01449 registration number 42190680 breed Hereford unplaced genomic scaffold
ARS-UCD2.0 Leftover_ScbfJmS_2319, whole genome shotgun sequence

Nucleotide count: 24,075
Atom	Atom Count	Percent	Variation %
Carbon	114,971	32.35	> ~0.1491
Hydrogen	127,589	35.90	> ~0.3099
Nitrogen	87,925	24.74	< ~0.6819
Oxygen	24,885	7.00	> ~0.2229
Totals	355,370	100.00	----

Promoter-Terminator Sections
Table: 5916 (Promoter Count: 1)
Link and genome info: NW_020190670.1
Bos taurus isolate L1 Dominette 01449 registration number 42190680 breed Hereford unplaced genomic scaffold
ARS-UCD2.0 Leftover_ScbfJmS_1573, whole genome shotgun sequence

Nucleotide count: 14,784
Atom	Atom Count	Percent	Variation %
Carbon	70,275	32.27	> ~0.0620
Hydrogen	77,765	35.70	> ~0.1111
Nitrogen	55,095	25.30	< ~0.1279
Oxygen	14,668	6.73	< ~0.0452
Totals	217,803	100.00	----

Promoter-Terminator Sections
Table: 5917 (Promoter Count: 1)
Link and genome info: KI270590.1
Homo sapiens unplaced genomic contig
GRCh38 reference primary assembly

Nucleotide count: 3,019
Atom	Atom Count	Percent	Variation %
Carbon	14,482	32.50	> ~0.2995
Hydrogen	16,015	35.94	> ~0.3503
Nitrogen	11,109	24.93	< ~0.4910
Oxygen	2,950	6.62	< ~0.1588
Totals	44,556	100.00	----

Promoter-Terminator Sections
Table: 5918 (Promoter Count: 5)
Link and genome info: NW_020191269.1
Bos taurus isolate L1 Dominette 01449 registration number 42190680 breed Hereford unplaced genomic scaffold
ARS-UCD2.0 Leftover_ScbfJmS_2189, whole genome shotgun sequence

Nucleotide count: 15,755
Atom	Atom Count	Percent	Variation %
Carbon	75,466	32.43	> ~0.2291
Hydrogen	82,801	35.58	< ~0.0083
Nitrogen	60,079	25.82	> ~0.3961
Oxygen	14,340	6.16	< ~0.6169
Totals	232,686	100.00	----

Promoter-Terminator Sections
Table: 5919 (Promoter Count: 4)
Link and genome info: KN150571.1
Danio rerio unplaced genomic contig NA910
GRCz11 reference primary assembly

Nucleotide count: 8,304
Atom	Atom Count	Percent	Variation %
Carbon	40,094	32.56	> ~0.3529
Hydrogen	44,276	35.95	> ~0.3588
Nitrogen	30,400	24.68	< ~0.7390
Oxygen	8,383	6.81	> ~0.0273
Totals	123,153	100.00	----

Promoter-Terminator Sections
Table: 5920 (Promoter Count: 7)
Link and genome info: NT_187626.1
Homo sapiens chromosome 21 genomic scaffold
GRCh38.p14 alternate locus group ALT_REF_LOCI_1 HSCHR21_5_CTG2

Nucleotide count: 58,089
Atom	Atom Count	Percent	Variation %
Carbon	274,578	32.12	< ~0.0833
Hydrogen	302,134	35.34	< ~0.2496
Nitrogen	223,644	26.16	> ~0.7382
Oxygen	54,491	6.37	< ~0.4053
Totals	854,847	100.00	----

Promoter-Terminator Sections
Table: 5921 (Promoter Count: 43)
Link and genome info: KZ115271.1
Danio rerio chromosome 8 genomic contig ALT_CTG8_1_19
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 229,445
Atom	Atom Count	Percent	Variation %
Carbon	1,107,451	32.55	> ~0.3478
Hydrogen	1,220,702	35.88	> ~0.2868
Nitrogen	847,246	24.90	< ~0.5207
Oxygen	226,782	6.67	< ~0.1139
Totals	3,402,181	100.00	----

Promoter-Terminator Sections
Table: 5922 (Promoter Count: 4)
Link and genome info: NW_003337234.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA3

Nucleotide count: 7,786
'N' Nucleotide Count: 200
Atom	Atom Count	Percent	Variation %
Carbon	37,651	32.53	> ~0.3267
Hydrogen	41,383	35.75	> ~0.1613
Nitrogen	29,013	25.07	< ~0.3567
Oxygen	7,695	6.65	< ~0.1313
Totals	115,742	100.00	----

Promoter-Terminator Sections
Table: 5923 (Promoter Count: 41)
Link and genome info: NW_018394469.1
Danio rerio strain Tuebingen chromosome 1 genomic scaffold
GRCz11 alternate locus group ALT_DRER_TU_1 ALT_CTG1_1_10

Nucleotide count: 316,121
Atom	Atom Count	Percent	Variation %
Carbon	1,524,931	32.54	> ~0.3386
Hydrogen	1,682,048	35.89	> ~0.3017
Nitrogen	1,164,928	24.86	< ~0.5641
Oxygen	314,131	6.70	< ~0.0761
Totals	4,686,038	100.00	----

Promoter-Terminator Sections
Table: 5924 (Promoter Count: 57)
Link and genome info: KZ115729.1
Danio rerio chromosome 25 genomic contig ALT_CTG25_1_7
GRCz11 reference assembly alternate locus group ALT_DRER_TU_1

Nucleotide count: 330,902
Atom	Atom Count	Percent	Variation %
Carbon	1,596,017	32.54	> ~0.3327
Hydrogen	1,761,788	35.92	> ~0.3223
Nitrogen	1,215,690	24.78	< ~0.6409
Oxygen	331,881	6.77	< ~0.0140
Totals	4,905,376	100.00	----

Promoter-Terminator Sections
Table: 5925 (Promoter Count: 4)
Link and genome info: KN150514.1
Danio rerio unplaced genomic contig NA855
GRCz11 reference primary assembly

Nucleotide count: 12,649
'N' Nucleotide Count: 100
Atom	Atom Count	Percent	Variation %
Carbon	60,419	32.51	> ~0.3105
Hydrogen	66,692	35.89	> ~0.2965
Nitrogen	47,252	25.43	> ~0.0045
Oxygen	11,462	6.17	< ~0.6115
Totals	185,825	100.00	----

Promoter-Terminator Sections
Table: 5926 (Promoter Count: 4)
Link and genome info: NW_008805394.1
Danio rerio strain Tuebingen unplaced genomic scaffold
GRCz11 Primary Assembly NA270

Nucleotide count: 27,395
'N' Nucleotide Count: 200
Atom	Atom Count	Percent	Variation %
Carbon	131,609	32.44	> ~0.2372
Hydrogen	145,169	35.78	> ~0.1899
Nitrogen	101,661	25.06	< ~0.3650
Oxygen	27,253	6.72	< ~0.0620
Totals	405,692	100.00	----

Promoter-Terminator Sections
Table: 5927 (Promoter Count: 24)
Link and genome info: KZ114839.1
Danio rerio chromosome 1 genomic contig ALT_CTG1_2_6
GRCz11 reference assembly alternate locus group ALT_DRER_TU_2

Nucleotide count: 170,545
Atom	Atom Count	Percent	Variation %
Carbon	823,630	32.57	> ~0.3668
Hydrogen	907,900	35.90	> ~0.3094
Nitrogen	629,010	24.87	< ~0.5497
Oxygen	168,247	6.65	< ~0.1264
Totals	2,528,787	100.00	----

Promoter-Terminator Sections
Table: 5928 (Promoter Count: 37)
Link and genome info: NW_019805503.1
Homo sapiens chromosome 18 genomic patch of type NOVEL
GRCh38.p14 PATCHES HSCHR18_1_CTG1

Nucleotide count: 111,607
Atom	Atom Count	Percent	Variation %
Carbon	537,612	32.53	> ~0.3244
Hydrogen	591,658	35.80	> ~0.2046
Nitrogen	416,320	25.19	< ~0.2346
Oxygen	107,186	6.49	< ~0.2945
Totals	1,652,776	100.00	----

Promoter-Terminator Sections
Table: 5929 (Promoter Count: 3)
Link and genome info: KN150330.1
Danio rerio unplaced genomic contig NA686
GRCz11 reference primary assembly

Nucleotide count: 19,476
'N' Nucleotide Count: 300
Atom	Atom Count	Percent	Variation %
Carbon	94,163	32.47	> ~0.2679
Hydrogen	103,891	35.83	> ~0.2328
Nitrogen	71,413	24.63	< ~0.7975
Oxygen	20,521	7.08	> ~0.2968
Totals	289,988	100.00	----